ExifII* (1"2i0-'-'Adobe Photoshop CC 2019 (Windows)2019:12:09 11:22:25 ~(qHH Adobe_CMAdobed            m" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Dr{0MO8C#'hS#n}&sTj;>( )vR '`[^ݑ~%#p Ў {@LG򿪕|{( !ÞcRS2LlvDt{w o>_ȤS/SQp5g؂PKj6 uVm{k^hn))ԶfNU91pKWo)Ҵzng}ODTحaQ8ȤGn>K"w;''x?(IOY1D %ڒ6O'zwT#Tո*&;G% Mत}W?`]c_ cWܧ7XOAr髳nHr3tgC0 Rﲦoe]{RK>Sa{[}S[="mfX6ow1qSbu@ΫҺuW3iCG=O;=ON頶@ss_AE;wnKECH*ÞrU% > kzizjϦ\zGNue5K7zU.'x}]msCT7fݙ/Jo`}6u~=L\/x4uZsr:L,5q_/uG?zL7 Eg :@~]=: 7%Kg_UKǎ^|n~EɿS#kG8¡k]EV"+26ƃg袆5RcZ5 hjnsR^ ${#}ILP-EO' 8Ax9R}}O*KO''sP29p{|))FG}0Zd| y_eV-ˠVםQg=I}gKYc,k^1淹[Y^YcgZk_묺 !{/9+m57ovRGI+-=6f\9shܹ >}wɻ~޺fӮͣ{Vn~S_2zcܖfߥ{U<77] :D5UĆ6V?sUmmWlv.EXGKmpX@{hu,GYtLrF;ϢS G˫)zOGΟ?UT>3|9Vf18Xۋh=-ͮu5}c_G2}>5P'gr5f;[*߬}VPy -6Sv=ڦo"*F V}^S1sCo֞}blZw)qVFE`xusU,>'V22ki֩XMivVO}8D@6źς1Aʉl|PS&An55 52j%?9?$O<׻:;GgV ?mZﭖ7_lIOE־>z[({_kcվݾߧb'DcTr-W,ﱻ}K-~g7VOOF EqcḐA{3$"džS|k{,?]_DC0ro?kOo6>-G[jH{}_SX:o@v;%ho/rIOCmc\<8.X`sOdϫWW~_7OFr^cMu7s6e ^to9}QgЧ#5/YccH41@\Yls퇃GX!n55%[6|gʩW<C% ]̴BdڷYz7U8u~_M܂Yׁ{i~'!N9<>׺ř9V,nzmLs=L7Rf[(JAzVuH RSW՜yj!ֱ>z+?eELOR~FmYQ4moG>*m4V)cjW[kZ֍ckXltvk\?_1㿘hx1/)쿩ZV3f;˚۽lw8Y__Sﭟꮛna2N-ֹWCtv{1sX>u^Ժߗc{S}jl]~?W~:{u8dZm{>ֲKw:/u'< ;gV\4=v#tC, kOZ_W3g sko~zԾZun3_ӮN-v1RJ}e@-!`}HG~繢t۬wѻ[{ԫ΄QSի3bThEZּ^t[:T}I,&Fcqi=ngvKaSUh'>c։n y;˃lǷvIOT6^lo?CnK1*hC O? =?He?ImNG3۽̅}nt\oaͽ 3` ~Rm_nҞuN69qg~ώ 7wi*j]o~V.qzc^쬉n5wc}6) ?p?1gXv1kS\uʮͻ}/GfU}st6 K ^Mkk 'K?~BG ?O(>/Yګdȱˏ+kuS:SbI mc6aU%lM>r͌&lSVG]cGX+ݘK0="2:ߣ:5tֺ`Ȭ3&=ƥ8o{s}|lbu047kX--hWĔCS~P7*ѐUōuĉxE㎦ȓl[}M^2m?Nhl߷k$NH=גAfGCFl~箂QE (xcr~vW?7t|mv}~7֒Ks[cNƏK?/?ݕ30~5Xtf/qeo}Ulw7 }빮cCւ+{pjvyzn&qūխޙoOc2(wgxz_ e[nsu}qk]谹ls]OEc}:Vy~$X#> .Vex; >r*ŭ:m;!w{G͕Pihe4mя;HOLJ 4 &&KHlsJd,qagۻo>+*7ܼE5;F3?2!2mG{f}Mb{SŤMR,mm}~s75ߜw"~-f$1KS1a;UPmIP.A޶owm+jkkj6OklۿSZ)k^x.&Ƶk?/]ȫcʞִͬleB`k!66HZ|Hx i?USU44?6os1Hc?jz_^}Ђ}ռ[?,(xVd^Zvrj#~}ߡq<7ɱg_ev{ůQs} v]Z[Fzx/ˮU{&>OBJw,]ar]S'( ud&=q Wr0=C:VԒXsYv6WS{-?2K.iym&ٹkdӳkmQEZN?=[=?%g}7ݍlFkݙP:$kW]?KZ-kȑF '"*PwQWgͿ?Eޢ#~e}WwBJC|>CK'v>7 O*Fh+LG˙`szzCs(鎫xc5\oì9x dxv{^$~72IMo8> ߹>7livTۛ_CKX@UF$~72IMܚmǮl][{>~7E0mhPd}:z/,/IͯkYnͧޮvzĔgǸ\֯CKJ6CFwuVEIsȳDZf_Wf~Խ?1?P?_WNmnx+:N%Om[x> Wz=vXgE ۘ>]]kZwٯjJwrYV&-SCC*kGяr1귺%ӎygPsѻS?$Photoshop 3.08BIM?Z%GZ%GZ%GZ%GZ%GZ%GZ%G(8BIM%$恬 YDe|8BIM: printOutputClrSenumClrSRGBCInteenumInteClrmMpBlboolprintSixteenBitbool printerNameTEXTprintProofSetupObjc Proof Setup proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM'8BIMP8BIM0(8BIM-8BIM@@8BIM8BIMS *9/JD challenge nullboundsObjcRct1Top longLeftlongBtomlongRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM m`q Adobe_CMAdobed            m" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Dr{0MO8C#'hS#n}&sTj;>( )vR '`[^ݑ~%#p Ў {@LG򿪕|{( !ÞcRS2LlvDt{w o>_ȤS/SQp5g؂PKj6 uVm{k^hn))ԶfNU91pKWo)Ҵzng}ODTحaQ8ȤGn>K"w;''x?(IOY1D %ڒ6O'zwT#Tո*&;G% Mत}W?`]c_ cWܧ7XOAr髳nHr3tgC0 Rﲦoe]{RK>Sa{[}S[="mfX6ow1qSbu@ΫҺuW3iCG=O;=ON頶@ss_AE;wnKECH*ÞrU% > kzizjϦ\zGNue5K7zU.'x}]msCT7fݙ/Jo`}6u~=L\/x4uZsr:L,5q_/uG?zL7 Eg :@~]=: 7%Kg_UKǎ^|n~EɿS#kG8¡k]EV"+26ƃg袆5RcZ5 hjnsR^ ${#}ILP-EO' 8Ax9R}}O*KO''sP29p{|))FG}0Zd| y_eV-ˠVםQg=I}gKYc,k^1淹[Y^YcgZk_묺 !{/9+m57ovRGI+-=6f\9shܹ >}wɻ~޺fӮͣ{Vn~S_2zcܖfߥ{U<77] :D5UĆ6V?sUmmWlv.EXGKmpX@{hu,GYtLrF;ϢS G˫)zOGΟ?UT>3|9Vf18Xۋh=-ͮu5}c_G2}>5P'gr5f;[*߬}VPy -6Sv=ڦo"*F V}^S1sCo֞}blZw)qVFE`xusU,>'V22ki֩XMivVO}8D@6źς1Aʉl|PS&An55 52j%?9?$O<׻:;GgV ?mZﭖ7_lIOE־>z[({_kcվݾߧb'DcTr-W,ﱻ}K-~g7VOOF EqcḐA{3$"džS|k{,?]_DC0ro?kOo6>-G[jH{}_SX:o@v;%ho/rIOCmc\<8.X`sOdϫWW~_7OFr^cMu7s6e ^to9}QgЧ#5/YccH41@\Yls퇃GX!n55%[6|gʩW<C% ]̴BdڷYz7U8u~_M܂Yׁ{i~'!N9<>׺ř9V,nzmLs=L7Rf[(JAzVuH RSW՜yj!ֱ>z+?eELOR~FmYQ4moG>*m4V)cjW[kZ֍ckXltvk\?_1㿘hx1/)쿩ZV3f;˚۽lw8Y__Sﭟꮛna2N-ֹWCtv{1sX>u^Ժߗc{S}jl]~?W~:{u8dZm{>ֲKw:/u'< ;gV\4=v#tC, kOZ_W3g sko~zԾZun3_ӮN-v1RJ}e@-!`}HG~繢t۬wѻ[{ԫ΄QSի3bThEZּ^t[:T}I,&Fcqi=ngvKaSUh'>c։n y;˃lǷvIOT6^lo?CnK1*hC O? =?He?ImNG3۽̅}nt\oaͽ 3` ~Rm_nҞuN69qg~ώ 7wi*j]o~V.qzc^쬉n5wc}6) ?p?1gXv1kS\uʮͻ}/GfU}st6 K ^Mkk 'K?~BG ?O(>/Yګdȱˏ+kuS:SbI mc6aU%lM>r͌&lSVG]cGX+ݘK0="2:ߣ:5tֺ`Ȭ3&=ƥ8o{s}|lbu047kX--hWĔCS~P7*ѐUōuĉxE㎦ȓl[}M^2m?Nhl߷k$NH=גAfGCFl~箂QE (xcr~vW?7t|mv}~7֒Ks[cNƏK?/?ݕ30~5Xtf/qeo}Ulw7 }빮cCւ+{pjvyzn&qūխޙoOc2(wgxz_ e[nsu}qk]谹ls]OEc}:Vy~$X#> .Vex; >r*ŭ:m;!w{G͕Pihe4mя;HOLJ 4 &&KHlsJd,qagۻo>+*7ܼE5;F3?2!2mG{f}Mb{SŤMR,mm}~s75ߜw"~-f$1KS1a;UPmIP.A޶owm+jkkj6OklۿSZ)k^x.&Ƶk?/]ȫcʞִͬleB`k!66HZ|Hx i?USU44?6os1Hc?jz_^}Ђ}ռ[?,(xVd^Zvrj#~}ߡq<7ɱg_ev{ůQs} v]Z[Fzx/ˮU{&>OBJw,]ar]S'( ud&=q Wr0=C:VԒXsYv6WS{-?2K.iym&ٹkdӳkmQEZN?=[=?%g}7ݍlFkݙP:$kW]?KZ-kȑF '"*PwQWgͿ?Eޢ#~e}WwBJC|>CK'v>7 O*Fh+LG˙`szzCs(鎫xc5\oì9x dxv{^$~72IMo8> ߹>7livTۛ_CKX@UF$~72IMܚmǮl][{>~7E0mhPd}:z/,/IͯkYnͧޮvzĔgǸ\֯CKJ6CFwuVEIsȳDZf_Wf~Խ?1?P?_WNmnx+:N%Om[x> Wz=vXgE ۘ>]]kZwٯjJwrYV&-SCC*kGяr1귺%ӎygPsѻS?8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMmaniIRFR8BIMAnDsnullAFStlongFrInVlLsObjcnullFrIDlongoFStsVlLsObjcnullFsIDlongAFrmlongFsFrVlLslongoLCntlong8BIMRoll $8BIMDmfri8BIMhttp://ns.adobe.com/xap/1.0/ 121A04B20041A484E3EB664D6991F56F 1CB4347C573818148ED5CC2F43D334A7 440EA547AA06673FC1F088E7F9F9A798 5D2BEA2DD89A4C3DB51B8328F1A83A54 6F914CAA0771A66716A1C4D6DE5295AC 73D3C411C88B6C443739EF5B5B583698 83C84BA06C3C46C969097920B41ED422 CB1504914A2526A5AE44BEF3B222CEBF D23E8468BB91DD68566AF3F7465FEF83 E597F9014ECBB009C8EE72576B154F2E FEF0C5D0ABA4C58399C316DB50944E93 adobe:docid:photoshop:155e77ef-fec5-11e8-9be1-fc0d38de03f1 adobe:docid:photoshop:abdad9b4-10e2-7c47-88bf-1f7c5c97d18c adobe:docid:photoshop:e8c6401e-25e1-5441-ac1e-392ea0862aff adobe:docid:photoshop:fc9b2d0a-fec5-11e8-9be1-fc0d38de03f1 uuid:828108F22CFBE0119CBAAA22F71D15B8 uuid:FFD5F3EA141B11E09C17DBFC0C45C84E xmp.did:02d51305-580e-6346-9a39-d705a2e793ff xmp.did:08a5b30e-ca6a-b948-a42e-f06f43fe7839 xmp.did:0BF517D212BFE8119F3682EF5F9E93B5 xmp.did:1577803473216811822AE12306974E40 xmp.did:23CB6DBEF973E711A980C55AE15BF40B xmp.did:2452ac91-5359-454a-acd1-c87f0748fed1 xmp.did:2DD0C89BF873E711A980C55AE15BF40B xmp.did:2F81269F7320681197A5B5154AC32901 xmp.did:3FE054B029BFE8118421826EB5FB4B20 xmp.did:471306BC853BE811BF15E3A49E538B0C xmp.did:4A1306BC853BE811BF15E3A49E538B0C xmp.did:4B0C4B884213E21191E2907623DB7699 xmp.did:5E5C3A9484DAE811AF94E61E44FB29AD xmp.did:5e11b092-2844-d542-8f85-a5f7ad86d5a5 xmp.did:76F1BC271EBFE8119F3682EF5F9E93B5 xmp.did:8504CC42D611E5119570C244900A54DC xmp.did:928E7D388633E111B97E9965897FDA43 xmp.did:95b8cdf6-fa06-b647-8b04-26b44778a4b9 xmp.did:9ACD591C747111E18F5FA9180BFFAF36 xmp.did:A5208A100233E1119E8BEC53EB0D7AFC xmp.did:A97D24515E37E111ADD9EE3BF03CC741 xmp.did:B9A4DAE2BB8511E68256FC3ECBF91521 xmp.did:BCB6F0EBABD7E811B8B5F09141EFA29A xmp.did:D6A5C2F4A7FEE111854DBABD0665084C xmp.did:DA523133FB30E811B7CBFDEF37180FDA xmp.did:DA806B18FC4611E08EFDFCDF0D8CD447 xmp.did:FC324914BF4BE5119128ACF69BE93D5B xmp.did:b7d3a201-29b8-044e-b716-e5dde5ba171c xmp.id:e7df8066-fe71-a248-bf63-0eb38c338c7c ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$7NByE[!V0>$op7s6|# C'8 S`ثb͊6*Q[WeL*~*p9.jP]mClUذȫlUذب@02v,;QMKN ).O.:K,p~;}NFw#\qȇ.]0f *J,R~E]*v*~E]p4]]J6i[='TA.v;2_ cp2Ii2.Qo'$7H^j7Qnden<*aq$;+;+vlUٱWbN~vX4]] 2\ئA.aWb|Uؠ4ąv*2*zRX @Ĥ;YEwŘv.`Kl!{YGㄖX{E\h~P?ѝ\) zakU]]] vv<!.5v?6*qiCFTċvy__msktOd? -s4TN[+FVTu%q7RϯQrp &Pثb͊V"U*iK,m.Pxذ" ظ-]KP0%ز;QMd{?^ <N_^!> ,%9]m63F#2!9'{5S=rZԫ`*v *i4Wc튻6WcB]x)bF0H"ݛEեnZdO]͌%ViqcGTWٺQWn9}2țq)SCXb͊V#]®jS"eL*~v9M2$+Lv8ثUxRv,*).Ob" Ix(:|qj#U6 XUኻ/6*ثb͊+vlUثyxb͊o6*jbf]k6*[͊6*lU]vlUثyXbe]/k6*lUUثb͊/vV*^*lU٫6*ثWe͊o6*ثb͊6*ثb͊o6*UxYVb͊o6*V*^*lUUثVb͊6*ثb͊6*ثWf]qCXӊ+oqWc*#oa[bH L1Wg*ז=@݂Cyw>].6l}B&)?`ǤJ|C$"1,*ثb͊6*i*TWe®ǃ\UxL v<ثA6 ] Uؠغv.)v*\E%>_HI?;|?~;Q1BC؟X.K5S=r!qpWeeWcH.. ~vXUx*Rث]4IAmI1 DW:uI+ ?dRGݷKU\ATSCm3v tukoë7e\<Vq9"#A6U=d[4ZmFiV+S.Ű+aWeK*x=+@{b!].Ŕ"Uز*X v*)v' S vH|qv~L?YEB.nCR{|o"Q8Sq-\٪`dML]vlUٱWf]WWc*~*p=Wc,]WbPz`"X œv,*T ;Q.jq ?HB1HLcVq'utho?{'*)l7alHo.WeaWfcU x5]Wc+ v8yٱW`kALeLd-?Zn0?NxӺqχb_u}FCPI7#ɜK|6n7A]v7;6*ثMWb|]lUAWc;dUM6®b{%ذ-Qŗm%حxG݃t2MZB L'd&\OvlUٱWf]vX4Uذ8xUن:6*zme]Wc.lHvQWb`KJXaΗ0=n?Ϧ-ъn"kv=*igi! #,`l%>#a%Wf]]]8vl UZ< v*pB.͊6*k//*R}f͍cs<47`=C?`1eبR8d-BFMMʶB؆Tvo#͸jz HXƬw$IWz䘻]Fp%ئv8y!xUxx8  0%ؠ8@r%])]Wbإب8ب8]wGӿ[ ta 蚜zջiiBсn;U_[OeD#S++r ch"b8Pثb͊,oU*p=Wc]. \]_ *T Uت"Bu.Ŕbŀ;Tv4MNO/aH:v?n- Qjzg/RY.Ƥ8h%_1v7LRW,vvl]ǃ\U{`!] ] ]vs}' ta y{ST=Cxdf9I~k[ip)"8'@j*2PaB2֖21WcqCb͊,`*XWeWc\U DĄb_ *Pb"E+`1Wb)v,]Ao%mh-h*r}wqlEN'anE_4]gcRO] 1v3Fp%ئv8y!xK p4*p8`Wf]7p׋aZ尕;:uhvCpFu(j2he#YϺGw6-s++r c~A)v pCb͊,n1WbqWeWc튻*Q=]RzaWb C Bv.].@R$mmMO)؈b]Ϳ ;wyF2HKHĒORN-rL].+SlRW,vvl]}0+A*p8Wc+v;6*-eF[1vߠ5&+o!o, (0yNմFki~D EFCJ(FZ0f]vZ`*[/  qWcǃȥ{aCثE5ȑJv(v<—eK[K4vv^YN^鞔bJ4Fȓnv8pY9'qv;v;v^*ثb͊6*إ٫vlU٫];6*.͊6(vlUٱKbf]b͊];5qWf*ثb͊6*إٱCW6(vj\UٱWf.͊vlU٫6*إٱCb\RءٱKbf]6(vlR͊6*ثb͊6)vlPإٱCb\UٱWf*ثWvlUٱWf]ٱCb͊6*ثb͊6*ثb͊5qKbcN*n*죊qWbdb$7aE(_ao-".4N(A[`qz&r֒բm_;pG+vR$ֿ6*ثb͊ML+L *iUآR.]| P *`!.k"+[WG) ["&jwBCQ}oR 3{i%,ORNM%Ȕ;6)v9OlT;.͊]] ] 7ذ56*vE®.͊6**?HG7a慺#boc1)vNmn\QA,9raiU k$żp5EpRUZ p!xˮ)v< x4.A]"bBV)v*v)=)v&2[ tel>: JAVHo0g9&Nѝ8N4 EFDYJ(G\UٱWf]vZ`*[v^v(Uآ`!!ؠUw ](]|]]%ؠEܝ;VVfͯ(nRDp Pbd43j^LWb%+V ɮ$żp5]. v)];/v^)v8HWc*~*p9]ȫ WeWf]PO @vr):O6٘ރS.k92xǚgJĽX Jw۷4(dl[+;6*ثB®W| ~H+U A]RYFvA\%v.6®0% +q)vt->/.Z6}07p * }Ctu_}3]t4VA5Ixk]Kتv] BPR~E] 1WcWcWcĄWc%](ÉUT6pVUO9h6εoQwG")L(oW鮬/4?c4*qRlG\a]vlU4B®| S$ ]BC@0%تv.N\ Uغ.һ RZe^^mN{8%Sd`;jYGA7g|*f)v()v)];/v^)v8HWc*~*p9 1Kv<Uxb‹Z 展NS'l NQNkoyvi'9d^?Zd6E=,\9 Ii]# ]cC؂ī.U{bbU{`!.LU U؜Tt8AnF7īN̿2>ˀe)?Y׭SSӈi8HS?^Hq (8gγ b\iFXb͊Mخv8xFؠ;]ؠTS|RJX bɷ4E/}E$o?. v8u*27쌎&,*-d9^#"r@4kRxF]+W]bJeR~E]v;v<%v8%]]e ˜.'nєxȉ -PSbk`wVO$7PFsmB>c=GĴH*I0v4ebf]v(]DU`v?v85v<Ri.:C$+\.Χ*e]Jk;{{4_;PI2,Nz"($F@2.r\MqaVVk5qWe͊5qWf]vj͊6*V*1Vb*jZ]o+k6*UٱWf]./vjʮ*^*UqWf]bvjebˮ*lUUxWe͊+v]qWf*͊/vj]6*]vV*͊6*U٫6*]o.YX늻+vjf]\Uf]6*lUXV򫊵o/k6*ثb͊5qWeUv]*i*L⫱&x8 UI(vr;kkV+2r@a""ќxk$tF‡f]vlUٱWeM* baWc*Yw.]&ؤ;]!i۾iɖ}~NrxaXPu9^7{;aY0佂֟dw4 ]v; /] 1Wbp%ٱWeeWcH.. ~vXB/.Αi .݇쏞*Cf9Y-~뺌zt#DӶ:[$k`lkӾE[`* vX4.b{bbc.p+aWeK*x=%ب8@{`!].Ŕ#]+bbWb`+oPzQ2Jc [[UL'}ag}dONB!kk!?|1a7۶`90mTPثb͊0+B%ب]إذd$wPAxԓA] 'L}Fa{ _ ckY_Ohx=%r/#ͳ\Sӆ!ƑV0v; /]]œ]]#,bbp+c`K*vv<L+k< ث%ݰ]2P1"݃&lYDQf+}{SKhwԣ -M.%uӆ!ƑV;/ /'eLUY;lUURr1K\ prCUٲ)v<J/ qWc퀅v?2)v<*vvlUY}kzяu9d%[1vL!(&jiHY?m>FD<ǡb֟?\v'윘6E/dbcpb͊6]P| v(1Wb)v,!]&#CB] 4=4翙muf8 en"%zt+F#ND\"/3ɳ5p8*&aWeKKزvX8be)v-,v; 6`Wc*p4B]c]͊^[z~퓄2ζ]4 9i ζ*nF3[Ft;ir!\O @72ƒb4c0b͊,n1WbqWeWc튻*p8HP~Eɹ;$&6rse^IeZr9=/MIKEh>{r.|c(%ōOSCKyck)vlU]b\Uثy6*ثb\UٱVb\U٫6*3b͊6*lU]k6*j͊yWf*lU٫6*lU[\U٫o*Wf]YVbf]yWf*]vj͊5qWfZ͊vj͊o5qVWo6*lUٱWf[\UٱWf*lUZ\UثYWf]b\UٱVWk5qVb͊6*jZ\U٫k6*߶lUٱVWo6*778Xv0L1Uؓ U؋ P$^ q1BE0* *m&źS'~^ \LEF\K}dUq,UٱWf]v< z'-.#"—b1Wb1Ke"%,xR]/M{VVon"mu4kqf2uE>϶HI{Wc$+L6*x5]̀;/,b0%ٱWeeWc1dزWe ́]:\n uG?q,~X"^*OI.gn$ EHZ䈦cCv^/]* زv<We®bbݎ$;/v^)v<]PUتWbqK`r<غ)v,v()v^l+;H;'.liBсt%űC_]K1-+I>[" A^")Px5].c / p+Wc1KDn]`Wc]]iDiv?"ǃ\%]]v_[v0T n._"-i7 qór!.1Et65eq;QenB&oeQ# +;)v^(v=v5ĥ)w baWbˊ]غJCe!F4dRnsHy^ˊѮ[?ϮB܏(o!a}xĴyJO|1ȫL^2ݏc** 1Pv,v;v7MLRW"$;/ 6}0+N!]dRx8U ثQn#9d%ф[)Z1!iGɐ q *L8c|s5Ìђ?Mr5dQRU#,joF)v7;6*ثiv+]]AWcl$; $-Լ'P-i鞎Ǘfz\w>vv8pY9n&(WeR~(v^*إٱWf*]WvlUٱVb*Z͊vlU٫Wl*ثb͊5qWf]Wvj\U٫6*Z͊]vj͊6*Z͊YVb\U٫6*]WvlU٫o5qWf]vlU[\U٫5qWf*Z͊vj͊o5qWf]vj͊6*lUثb͊5qWf]k6*5qWf]vlU٫vlUvlUٱWf*ث;]qCw&F*LUE(k#oaĈ 8{K}A%MFp wDHk9Coɂ%W"k]]v8 Rv(v8 bi!. `WbaKUvQ^;ge1G4dIgiɮ{l8_'}p)p >edib1I8ebc*(v9Ol+L04]aWfٱWc! إxٰ`q]]vlU:\!45[ʃ1szdVF;|`0mRPdY2塩PPHv;; qWcٰ%{b]]g|)v3v*)v?1v^%]]LUUr'ev8J]ȫ]{)ؕHeЕ"%XǦq;r~51E`Wc*x@)](.Tb`!.NX8'W"ֿ,b/,bͅADv^v8ثPإxث@k.]]]#+Mv)]0m uG? 1S"eL*~v9M2$+Lv8ثUxRv,*~*i`];].v).*P+Pp%زzHWbǚS.T`{ar} %‚-د5KKw;юt"ruo5h}u[1QP?C9y#lO-g'Ռ|'98QW dQQ\RX RT U>#)aK mGt|?EE\Wzȸo OGF# )e>#9}'ӏ#j cRi.:C$+\,bcWeK`K@,bWe ] 7.ŁcCvlRi5v?"v8`Wc+!.ǃLU U؅ p7R`-Wd- |2q̂x\k/!oK 4{TݐmzOQ۽=2`I*``0)zBb1W`xƝ\ِɞ}zNn)o>d!kW)h@6b:;|DSE>#9׮'Ӎ#jeػȥ` ]SM$+Lv8ثUxRv,*~*i`];]]Wc+v8`!]ǃ\%qWf]m}2p  vΓ7KY7 N)TNBJ|Ѣh*;_O|lը 9]ޢ'* (v8bc)v,)v(*mr%!3WO|}-w=wp2$i#dIe9t[oN3qmWb\] 0+NU`خE] 1C;67ŐvX4]Ƒ. 7ذ50;Wf.] 0v?x4]]m mױ9(˅[>ɠ]fNxq+9 i lEխqT#p+?AqiǨwunmߏ잇,LpPثb͊@cAۮDdʞ[mr+P?sdIm",{g E% P6Ľw8+i*p]]vj͊5qWf*ث늻+vlU٫6*]b\U늵\U٫5qW|Ww5qWf*vlU٫5qWt\U|]Y5qWf]g5qVWo5qWf*jZlUٱV늵5qW U٫5qVbevUqWf*\UU]Wo5qVbˮ*UqVV򫊵5qWevUqV隸Y6*]vj\UٱWf[\U٫yWfZ\Uu[ʮ*lU3Ww\]evUqWf]Wq͊lU٫5qWf*ثblU+v4]8\&تIC"1Wbdbኻ9|^~;.>l}B"'g*?L_Wb]\RYF)v(*o :HvM- W{m-cO4=+ш?_$/`49IW qWeL vlRp=WcWeMC@kWe͉K%`v).͊// F)vV)v(]vtoKnhk>y~cBc,l(v? ȐC®`v;Nv;v7LRW,vv^ǃM+P{bJS\%v,M)v.l PR.=x:./u M驥#'S>찆xСO_ϡ~քVM'b4=Fs-AOCTQQ]"W[^H-F"[cZW%ޠdIZb?dr/#ɳ7gc2Q",`~*iȲvX4‡ciDv)v; /]]œ]]#,bbp+c`K*vv<L+k!.ǃL< ث RTQ`+j[E7?㖐s/Q4Kl*?lQ܅r$&&(6)vjWv9Gq]]^]'Lkmݛw9`%Zi0 *g#r:?Ig#ðREy6rF򕷌J1qUcc] Ȳv8Pvv=Oc!]c]]*v,*v*n)v9Zbb`cdRx8v_L Po,+]®u͊ 5+>c}B]J.ɿ.Phz""ߴa { OVO 3/ x'ɂE*b||qC<1Ke8x.xKUirkS7r%1LR7==Ϲ>[$xE^gtUR?%*JX~*p4wWc, 0*rlr$+Lv8ثUx챶)v;Nv;v4be)v-];]]`Wc*p8Wc+"Rp8yٱWaux=džN23ƈO1@9i >Iר5To\2l[\u6ؑ‡eb͊\^vK=]Jt۳v> Klc{-v9fä[% '>"F5K3S1Vثyu]b\U٫*Zˮ*UqWu\UثyWvj*j\UٱWf[\U[\U[jf*j͊vj\U]y5qVWvj\UثWwLثY5qWf*j\Uثy5qV늻+vj*Z\UZ\U٫5qWf*[͊5qVb*j*^*UٱVWk皸~٫*j*j\U]5qVYY6*L]Wvjf*Y5qVWk5qVWk5qWu\U,]vQ]8Vv0dW]*IWtĈ "1V&p B*g詽HEm%?'Od .7(zXL&L6ԩ)v*v,2*8iZcȶټs&67ShmN0{ OPQEy6r]b]S.͊ qWeCئA]v<WefR] 1WbثKaKٰ+Zo$憺# p+v<ؐvE. ® E+ءk/ ].Av^)v<We®bbݎWecUi.]*UZR]Mr<ز6$$;S۰P6.`Zڇ.f tmJ/05 hf$qlPΦ3zg>twkIS?Qչ E90 cŮnd'bҹ,'&MZ$!ئv^vX4]]v=OlRv6*x5]ǩ퀅v?" 1WbUٱC2vlU=KٱKK*n)vtoOK4=<_k/*P!.c;/v* rejw9IoPv.xLk:L{qEXErꪫPdiw2j2mv1M>Xp+v^Upv pxPk;+C@k/ ]])xk]Kت5v8 ];/.\Wc*~*p9v8J]ȫ]Ev89u twjJу+F_ [Y+΄?8~>} y7PX K[àZ>/as}S|G\Z6r'Ƚ{R6PaI5䘮]+Wc"B/ lUUٱWb/]b1Wf‡bkDv;,bCbeKb)v^v^)vlRaWgC{$C\ WX4®ǃ\] 0%ؠ5‡eLHWbvX4x5 ,bc+—e K`kvXP~ bUqKȫU>8@{ऻ\ v, .*p+cgnA8KV-u)tGx//̀meV:sֳEN5R?m|>c1m(խU0u8M"rsiNtMh Ucec:ra9Z^#9]dm@<_ӎM$;6*z6B®ǃ\UxBK%kLUؠ5Wc(v?v^6 qH..nj aKز~x v!ĨvX.U4]ؠWcąv(6ڻ7]LRkƲ)TF#dS?_[c)F^0t ćX6o~%4ɁMY'ľ4='~lUٱWf])DWeWc*v*v( p%x`ͅADv^v8ثPإxث@k.]]]0݇쏞_G1U`v?vX4]dRi]®)ئ;lU* v^)v;Nv?v4Ri]u®cS\Uت%ذS\ vSNWb.ņ)v|?/Ol%LLm~Y/n-ߗXN*R'/u}ߗ[4""aeLHBӿl%%?P Bh!ȱ/)ʵ;7ҟ對86Ycf]vlUآv=r%]®乫r)vX4bp`خE] 1C;6 qd *~vQRi)v, w bx`]))v8`Wb7"B]LUؠSv[Oױ8c*A,uy|vV`L̞#{29J^C:4z w7 sld = ?k@:ԁlt۰\'.J|GrR-ڟ對8>XXb͊VG] 1WcWeL<ئE;]SM$+Lv8ثUxRv,*~*i`];].Wc+A)v<`!]`Wc)].pK˦*-l>OJ2;gJe񥴍o{9yS_u痒ndQȷnKE~_kOѶtOoþW)1.?m(oބGjw>',iǑl%;6*ثbU|Wc*~*p4sWci+-]U`;]]] i]# ]n1K`k b͊]]v8`*vv8%i]^Zf6ٿdeH"݁.3 ?Σ Tu2|<.oX6 C_> ϒΧ),T@@Ÿl$S/h *T\U]Wvjˮ*]YU[\UevUqWf*]Ww5qWf*\UUjˮ*⭌Z[͊\UZˮ*]\U]U\U٫5qVWo5qVWv]qWeWo._<*jk*Wo6*\U5qV򫊵.yUZˮ*+vjWv]qVY]\P\Uu]\Uuʮ*[\U[\Uu]\UU[\Uu]\Uj\U5qWf*j\U٫͊5qW|Wwj\UUqWfojVWvj*Uӊ(Uؙ80$N(v0*8xqUÊdRqݭ11<}}j;*) N_1+-4R ='Ֆ}sSiVf]vlU`|Uب5dUxUxv^*if.v;vX4:xv^;6%.eLUئ6*R|Ć}IQ[i*{Lii^77ͬrr)Sdثb͊6*YMr<*qWcWeL'uv)diWcc!]`C]®eKزv8UU1Kvv^Wb|RxBؠ"RzyJ`Wb3H!CE@&;;1^!Sw?2 `qC AR׻ğb;!?WٞBxy>aWRY-<Sa-"57Kas?>Y mIt_MgN8̕W`xZT%XP̆bcqCb͊,+\ *p5] l$;.ǃ])DWcCv; ]]Rx5;KTj퀥 p!*)v( 0+@0U"vKU)]ϨJ,@rFɷt΍kot${z%p֧aK;)n\-7\;gMҵh4Q`"܈ `c52E Z\u~J(nB94.bQ\h$F;6*ث`kWeWc튻v<ؐvE. ®c!]c** *œWcjlqK\<*x8WeL Sv8WcǚKWdn[KPZ@M?akMwo(yeyث!]`WeWc* @k/]PwLUؠ5Wc(v?v^6)x])vWLRUM~x] P~%!:KUbqWbm%%wœ )nDv2GI/Ѵ+fu a=T{mxEngܺO/~ Y6P`U Y,%Y4 {94@aC)guoGP.t֓n8F# p 2ARTFd5;+vlUٱWf]SOخv^v8a] `K )]ǃ\U)vl v8ؤecv]+.bk0+AcQ\+U]Nv< HWa>wZF#d$]-KBmkSR=T}eܨ;s3Fc*UٱWf]VWbxUk/Wb v^ piJp4—fc)x aKKU5۾v<`Wb;1)Tov(v*7ȫ(ԮD?'a"wJEmsTdULB<;bǂSQ%nLl:*UĚa#ĪPcjӦMvJn`?w-hB:L1٭ž*hsqWP%M$oȁ.]6*ثiB®ǃ\UxAWcc;/v* r?#SlGv= 4,I^~ .dkM{xMW2֭E.`WeĥJO^4cmQJ+2/]1 ^C 5"4{YETWTYJ.FǨq{hm_T?d6!K $;vlUٱWbkaWe,a;L'eL(v?  S*vv^,m]œTœi0+P0@0%غ`)v*4,)ͺ8@N4*MfTB7'X{ߙcPxrFNW2֭KٱW`k=QUC%Rvyc[4O奜'[)ȕuMJI~'SQ~9vcf#n-Ɛ\+94;vlUٱWbȕv? 04]b.j~A.Uئv8`!]dUqCUxإ0فذ5`Wcc`K`Wc&aBװv_9|w BWH8ʜ{A[[k[[XUȹRw=pH-eWv]qWf*ثWvlU٫5qWf*]٫]Wvj\U٫5qWf*]YWvj\U٫5qWfvjWf*]Wvj\U[\U٫5qWf*]Wvj\U٫5qWf*]Wvj\U٫5qWf*]Wvj\U٫5qWf*]Wvj\U٫5qWf*]Wvjf*j\U٫5qWf*]Wk5qVWvj\U٫5qWfvjWfvjWf*]W5pb\U٫5qWf]Wvj\UqWck*ء}1"qVWblUؙ8`WN_2t6FҰOprt ѧIj[fثbNbPEMtp'[,ζ+kCF~~=G$,+pj9 п8Rn(vlUٱWf] 7]]*Uxv^*iٱWc튻,a"S ]S\UxPJC^a~h{>yF)~cqCb͊,o/ lUAWcBc,S ®ǩ!]c** *œ]*bV3MLJ]ȫeiبUذN ^LvһZ˫\bU*Zf*r]_Ǣۮ!mUyM! '}|Ke5ȫdoR\ب8:]]-S >v_,e ^%>!sHm='f*#ro-Z-_2HvlUٱWf]*YMr<*qWc p4wWc, 0*rlr$+Lv8ثUx]œ]beSA4`+E].KN@®ŀȲv !58^_~n9M>!Em*j(&P{q$8WExd]͊6*ثiB® 1WcWe)qKثv^;Wbvo*Po]] m?{f?݇<TaB6_.͊6*r|p+v;*x8Hv;] S\bbv^/]c)v(7c\*1d`KeTm!{4w98bMɰgSF?\ }ÙIlܨspp}A@_FfMV14(M\Xb͊6*r|p+v^Upv pxPk;+ء)v8aWc%CadXoWbW ]'`v=pv.0%_R}8@bKUGu[P?K8ܨr }B15;%M)2lG;aE"Sc6*ثB®ǃ\UxAWcv pxPk WeK`K / p+\)v7VǮv?]OOݧ^@`K+~T?=xIoŏBO-~s7!늻1Wc5qKW;5qWf*jf(vj*]W5qCWvj\U٫5qWf*j*]Wk5qKyL]YWvj\U٫5qWf*j*]Wvjf*[\R]٫5qWf)k5qCyyy5qWf)vjf*]YWvj\U[\RjWvj\U[\U[\U-(vj\U٫5qWf)k5qCy]٫5qWf*j*.\Pj\U٫5qVWk5qWf*jf*j\R\R뚸Wv0UU.&qVWbd(o'w';8I‚ip4]J]b&qe."U) b)v)]1*켊]]vQ8ַRi-'q 5vb{z FOP[8˜c=GV(aIɱv7;+vlUٱWbȕv? ,bȥ`]u‡c$+AWcv*0c'bAت] Qv, vX7Z$w )z9G\/c-Cp3clP 0sWb])ǃت v,Dv,LUغ v**F%^'8A"݉iϦGeµkM[ Wo_뀆FRF嚝kstq,`ثb͊6*zcv)] 7]0ؠ5B].ǃ\(v:]WcثQ]v8 )Fزv."8xv>I-8)Ӱ@҄C)C anG\P҈`(^#~D1~X8lUUr*p=c!]]t C4VSi"xu|da/!CF+ȆaO׺9<yz >~DDJULcqWeb͊6*UZaWeLUUi%`v)  1!] v*0ؕ (Őv(bb0+{;].I/ a}er?r# )ou7j|#׵BpoQ9[hw=pb~8 v;*x4U p8Kv;/v#4Bez8AnuW8S H{Ku=eiylJ~ SFsj]nb~9(ɢA[H;vlUٱWbݎ 챶v?*켗5v( r$%xPC%]\ 1Cٰ%kAvX4.We ]],oqyC˿!zK,pʄqWvp<09(I ڔ!+E֟ȾMX$>c#ɄKѹ|\۵=;mR͊6*ثt]\%v; ,UB 0N]S T`Wb]WbWKU!غY]mo% Csp@49)n-:,}2%AHg}ҭ,vvl v8]ǃ\UpWcE.]vG5CTB݆췇N9*n)\&kYǺ9i2W*4747?'DM)\R Rإو®cp+WeP*Rثb4,%vN04$ha~& dg7FQ{،5\%e*hzba.͊6*ثݎئv^vX4v?v^*UOl v?6]KUڻO +q䝮G$06qG?̮UQ4og"+CU#ˣ+k"i}nB ?݉ 1ԬVx>9(ESNMӊ]vlUnWb}0A*]%c] *Pmj9+U ]w] R>%ZUiNf@=9"[b+rǑ2+j})aWxdXHڢ aUk-].ŕ`Wc!ĨvX*TUؠ9Vز`WbqKPp+C8IvG,lXO aJ--H7S{ qxg1ԬYRdڇaQW둮ٱWf]vlU4`!]WeWc*p v\*P{b C]® ;Wb C]*,":ƕP{{b['5[DE@ r]}8e8[w#RE<vsYUb+d9884S[jh߃ߎR2 G—gzf9_ETjrKbi/I.q}gXǭ?Co2Q2i=Ah}QF VɆj\U٫f*]Wwj5qWf*]\U٫5qWf*]Wvj\U٫5qWf*ثWvj\U٫5qWf*5qVWk5qWf*]'q\UZ\U'^6]'v&N(w^qU;XsTTl gյ953ld_$\H^"T(X.`Kb/v^)v^v4Xjlpv)]0v^;/ /6*+]Z]Ia2Cu9%"dP_[@N[d8hhs\۰%X"}n) \Fv4eb͊6*ثU5"B6v<ث@0+v,آ튻]—dT61sP#̼UA"~iYou6pۨxKDrP;ȆaOOzKqZ ެ`%m 𰌒]vlUتv=r$+Uذ 5v,Mb͊6*ثDn S,{aWb2JY|pS'c]eE]R\`Wa=!7jl:=oTQ!Ϗk9[hȳ?3k_6]G|)vV)v*];/`Wc튻2*p8KWeHE( am5Ț=vexKLIhcqZ OAH _dn(vV*ثbU|Wc] p9.jXxY;6.aWb˶%FE]&)v-vho[3){d#kSmBp0Zg+r-7=r*$A*~v4)v`i.Ł0;]]5v;*p4U x8Kv;/v!<uz8AnhڳsWsG_ p%֜)B҄ҭO#t{Fsj6|kqpN<bn(vlUٱWf]+v8Wc+v?v85v<J].;,bBv8bc*cB%/G4gxضㅨ'A[ R.Yco\Uu]Wk5qW{*j\U[\U٫g5qVWwj\U٫Y횸C5qWf*]Wvj\UZ\U5qWf*j뚸Y5qW|Wu3Wvjf*]5qVWw\U٫5qVWvj*]Y5qV隸Wk5qWf*]yWvjWk&/SDmn힎BƚF*'eRsiyek-0pH$7㞊4}0-(Q~ᘙt}cSV0 u5 n5`p Tpq1]f-ğmn|IXCq][S!&s/v&"hZSzx`53Q d!,OW.&,;aVH9\Ձ/93[=6iB,|CqJW0zL. ʩ*:dkQ NA! ڙ۹̌Y3i݌ܕb s꟒~W3WtQFD=3i=#>E-B' 2A_ċ^-//e?eCQ llyM=O_Uv1]&MF<4W+@+#C oq>Xr/|2B.-H%jKCuKiRT*OtJP!6Zi?/ !;DARS;6%.eLUئ6*R*iXتv=p+c v^/vlUL*)W`'Sm6Z=L/2ik-~xq$]'+1WZ#aH^=srA+%0Xb͊7LUذ5"bUذ5]bغEزb`eݮG$1-\}| 3]` rQ v#jL\ ۿ"4B\+YkӮjyGJ*2.V^6)v8UPثbv,Jx®l T )v(a;v,Edv.v. t}%/?qf=~_Ѷ*9߳r$-EL b#l(v;Nv;v4be)v-];].. T v.ز*X v** wo/$cT[N$Yݓ|\BUwu+cyxEg#Wcni퓉 T9&.͊6*ثbŕ׮DnjU*X )v(0PXNWlU!Epغ퀅vQWa`qqgn# Eb_Ѷ(r;%EBf2@4bfbq] ®́.]Wc+ v8c]͊\ۋ~rQ v'jKmE;etB\+YkZ-[*L+r?9`6E. vlUٺb#]U]KE C`;Y;MWb0tl vQ]z}_Hlv>qf0Z?Fx\,keB&UqiCزv8ثثS-ZضvX89!*p8 ]!]\]5v?6*{k/4c8J[ߠM?c=X[)/[ŻG\?r2ijz;6UN&$)~#$cqCb͊6*UZ<%v? ,b.jS eL*~v8`!]dUmiRj1,"߀vkx#[xP X'Z Pˮ*.\U٫5qWf*]Wvj\P.\U٫5qWf*]Wvj\U٫5qWf*Z\UZ*[\U٫5qWf*]U\Ujf*Z\UZ\U]WvjS5qV隸Wk5qVWvjf)vj\P.j95qCWbX9/_ @WoOߌ䟘oNOvU37#T=`Ѐ,|#{#wv1qr9<pJ-iDHXGD:%n@Ch8NF0_(4߮Y 6S a4r% j]rWeg77x#!-q !3M}}}#U鑗KFC?M?ƱM%okZVb 6U{ SLA S;O $*{w=0^E)NDN \ث僵zOGw\<- *Go|mNV2nݹ8qpIys̾W/540B78Zm%jmxuȌ;~ϱZ\9jlC_^g􍺰 ӒGssƟzKXH׺C0Wz|q1 |rogQM; 9GyN.H:۹zj{ ]Wu3W:\Rj\U٫5qCW5qWf*]Wvj\U٫\U]l]Wq\U٫5qVj*CYDV]\Ra8`cI ]'oN*^]*Ѿ#݄w9EZ\ x5®̀;/ثdUR0+e5] .͊6*MאvH ["Ob{|pE;-o-\@~?cjkj:i]v7;6*ثbpkA.nj(v8bbv< RUv]T`dP U&%.xJ@vN<[# x s5v?6*{kQ>FN2ht}@췇ˤ] 45z~,kC%c57vlU`#|]v*P0b d]<0BqhȲ&&n,ağ )Lf@盪"mn`Y;v; ]Vȫ®cB 0+PqKE9T.|%v, om->dF+ޔg ^E"ΕG1/OqEnC 5nɃm$RC vlUٱWeBK@1Wbኻ ]-]@2v,aW`cklӸ!V9mMHnSFް sS sBVcDɵ/] 1Kزv8ثث-Z,R[,vvl]`Wc*p8Wc+"c]͊ }Q 2J[AԒd ݷLdO-e t+STLlֳ ߨFȔWQQ#h57vlUjhj0v ]F*UqWba.œKt8U!F*0yC@$w [h7?-jzdcR+V; * & *œWcn]`Wcǒ]] p4*p8Wc)v<*vvlUOkO6rrA4'N-7rD6wQeM_L$&[ٌJkkmm$R FvV(vlUٱWeMWb|]lUAWc;d{aCKG42*H;&G@-ݺ1>Dž,e\U,\U٫5qWf*]Wvj\U\U٫]٫5qWf*.\P]Wvj\U\U٫5qWf*]Wvj\U٫5qWf*]Wvj\R]٫5qWf*]Wvj\U٫y5qWf*]Wvj\U٫j\U٫1۩ ʢe.(s#'YnHГyip}1Q eImim Ƅ~dv\M&v!(ѯ%zt{y=FeDMI9<,[_J^!U^H7 w L`X: Q_V5s+Pmy175 4Sc1z|lCŤR >&8?60 ZJJQO #k7S;3#>-=̟Oʅر)QN{afh5K94J%F>(v'f1E[|<Vr "u4*áϓ{0W,M33̅Ax'nOOȋ b8d/m>TkqPf*]^j\U٫5pW5qWf*]YWvj\U٫5qWf*]Wvj\U٫5qWeWvQ8UWf*a8`cIWt'v0UN*FŮ .J OQG5$ԓdF.BWfL(vlUx;6*zإ إxوv7,o]]+WeP*RثbdOAWdFWQamw2#Mbj_tooɂ8Rk#1$JٱWf]v(^ v(bbbb CuZ02v["(]8gB-p^! Bktcsn~c)v<%]͊ ^5>?[ ta iB!TcC2)L&GuV6XMr "&ibCC퀄 xزQvMC X vAb J%#mPݼOdm~3퐛ۦv3Hk#JSl'&Mk.́.Rx5EpRUZ ~v8BWecǩv("Uز`)v,v.\RT To]15$ "%\1K<b0H(r5⎿dZePj*2$cb(FMn*ثb%(o)v,Ŕa]X 'a*`1*Diw{\h*G4퐫붑Қ)*MIjv8eWedqP]œWe®cѻ`KL p8C%kv8`WcWcȕv8U] ]v?Nl%фO]o;BD6D S?鑝FĽA6˶Z24E696cHWf]CN1!.#)v.TdW`"Yb`KɦcbJ%$z5y[98Th:d.c<`)*MIzڛǃ\P)vl v8ؤecvb+.bWc!īK"LUUrb*YWf݈?ًx='PE"F܃7m^F?W-x&ڤmz΃k*-`Y֘(ifĚ{`Oo5%T+Wn ҘCZyhƕ=rbY+=>BdBМZEXj l|C?1jɨ hZ&72z%jF8ݖIZ VXr ھ'2c 䄋HUăѴ^IBa/zuYS ^=7T ZlfR kN8TYuDd,AV?|r*JxfnfYF[yVN# t0TT|fN o4r'46+zea𫨚$?XS…TPJB,|#])4'%{4e:5Az.l{ōC,E5x`MgzO,㷳''< K`gDYLtO+j7CVSjWnqĤ,z*+?!5mHCmȤz2w=t\ߛj|M'?F_pJIUn>(ϋ3̵̗j\U٫5qWf*]Wvj\U٫Y5pyZ\U­fvj\U٫5qVWk5qWf*®\ k\UD⭁'_JcKbN*4UYjqp5۞bR yWR_L7Ƨ M@=KyxPQMr$+`v? /]v( qK+KWe.cp+WeP*Rثbă4%Wd)!Z [am9/^FQס<(ҧ\#e*hz;F*n*ث]*^6pb#iv(v*uذ51%ɕXg!M*6j0uSq">*OSOʴQ\pcrn~cĥWc*UDTP]3|qnJH|2ȧuyt׭n)u;oߨZ Ljc d 6]*v(vX.9`KE]bb0:"dMK8ƕ?[b+u65/&mBR%Awb S zd'QqX1=0&1K]!윉W`1KUBRYF~#ӶE.vfoUkxL T٫ꚉs362U)i%276j&fp4—fc))v;1XتWcv;PJeLR~E]*v*xȫ!.LB]5Lo'Eǽ:̹x6:1kvyhj8 `49u 3%]E$^iUr?Lӊ]vlUjlz`!]`WeWc* T)=0:/JSSOK}݊PIp7Wc*WfvjWfvj\*\*]W5pW5pW5qWf*]Wvj\*]­*]Wk5p+y]٫5qVWo5qWf*]WvjWf*]٫5pY٫5qWf*­fo5qWf*]U٫5qWfvj\*]٫]_+)o-H,]DA#Oif?wUf'Ǒ iU^˴:8ӹ+}A{kKVrZ~ -cRP*}c)i<ާch'A\j):\1–)hV[v>펛MfKsmKL fî!j_YoJ3|~Y VZnz"},m~$ rL] 1*PUi].́.ǃ\R )v?()vWLRUMp+AC*qKv8ثثl+v?/v',K2ߡ aE%ȕwveb hdQxƧc[ɹ"E6{d-'m2S LUt®ǁL x]5J]]R \Ϸ|FaYjl:Zƥ"4:?DNE!7&f'M$G&iv)WcaWeKbc;,bƑ]o]]v8`(v; 6jvv<L]ǃ\%i5v?6* ul.SهC[Vm"s ǁw4B\+Ykn;Ux VS95 N׌|'ĴH*aI&.f]vlUآl]U"(C&~^HIL?ѣ;|? m-JG(:(6! vX—c\)vjfvjKWvj\P]\RCW 5qKWvjWfvj\ \)vj\U٫5qWf*]Wvj\P.\U٫\)vjWf;5p%٫\RfvjKW W5p+W W5qWf;5pU]\P]٫5qWf(vjWf5qWf*]W_YYۊn"A..sE_/$C*SD4G=w,8i}R%Qspgڟ^mԖYcsSc]M2s_΢9gd k@| n mͥ#WUGBaIVKE0%5*/\Vw(E8 e/N2[٬GHvm8iGmj[=~3T:0'w+Zb5Ȁ%I!)$@u͎: $c0{b!( behK p-0^A3)Tn|q( +N^ٮA}D'i7KBNDI)^e5nk(]+:Ga(riͧ/#Oo dZҾ QZ 3IôO_24eSnAM ?awU8Hep<旕Fb +\_ƙg4Lt=\T1 #~8{*宼rv OUϙ7Ik#Ap$RASquO5(_( 1vj\R\(vjWf)vjWfvj\(vUqK\R‡f*.\U٫5p!٫.ʮ*\UU]\U٫5qC.Ɠ\UqUw]'v4UqWc 9w5;c܏>?!Eȸ4ԿٱWc]] 0hv)Weǃ\UxPؔ/] 1WbثK𫱤bebb"b ].]vQ]zVl$ܷYFT~xcBu#h*iW0W$/pҞn!|A_] u0xWbbqKZoDذeV쎸 dWȶF+X.4h|#W:-Q]sITOT6 v%j r8`!]ǃ\%i5v?6* ul.SFJ2n&tVCE=d\+Yk/o o mMͱ~cm$RBPqWb`Wc)v*.ib&`nXF6~1iZ~kOr,z-Q_zIGSrpDrHvX4‡c{dHWbp=Wc%`'c튻E1K$;].]]v*S\Wbث`p%ب8_R1%Ld-ضzdY\{ )]#,~!O94ڵv9$ K !1Wbw.Ŕw.1%.QFd8ERT 0*zv8ثUxi]œ]]8jbb`cdRp8v; qWcB]j~vlU[Zz>0>񓄩ߦFv~l{{e >M׸Z֘-/xVQի o``6!K‡cqCb͊6*UZ<%v*\\U%4[Eݼ1Nux#mQEdV*uqV򫊵\U٫5qWf*ˮ*[\U٫\U]WU]yWvj\U٫5qWf*jf*]yWvj\U٫5qWf*]٫]Wvj\UU]\U٫5qWf*]Wvj\ ®\U٫5qWf*]\Uu]\Uu]\U_ǯ4I:=EFjSxSDZTZB>y{QK@,EfcpI%uh<%;í5XWOl/tvjd#mOvf(\_=jwVu 6  _Lb} lZŵũ?cBO5,Y[`͆L|f;%%8:+$Cw>88[%]j$'n=pJ'ĚQ7% 6>yԆ wi化dUY&m;V&Y}(!71}ɍlPXo͏QmWpD%B҃(1HP!śӼ{+VE+@o.K<0*73Z!~>]b%PKqA$ 8Iy_7Y6(CC> W4G,ţ5?L^_1 P!)%O>*YAG7z/kfŴbX(j]Ԫ6J)⾅qImo)Gs3K 1G>!ƞM1CY7Iv݃ mY\{$豇qޒ-?rqa!M\Av#L Uؠ+bbbc.!$}IgmL:յ8K`#"> .>3yݦv${qrCqC7b݇d|e7?1v8+kKWfB_V1,fyRI6v1>찆XЬaObZc-m67SpIW]&beUM{`WcWb*P/)v/@]RYNA MHM*mo a<*`r5=2^pH~6|1mRU<c dRrPvv(dWcCv^v^Nbp+URz7c.0+®cUi]])ȕv,.ŁWbJ])v#C.0v?Ie{)0#zFhxu?bQ^  poDRh!بتUذز)$.1XcvdDs[IA 4}*`s5=2^zSY1IWZݎHP~E;]S"Bǃ/ /] 1Kزv8ثث-Z,R[,vvl v8]ǃ\UpWcjvvlUW֌|cf9%a%u>e] Դٗpi&+"BQ#,jo/v:*UF)v*v-5z. b"AWl M79&T żuĚlTjzdP1>#ip.{bBC;])Px5]]Av;Nǃ] ]Fp%ئv8y!xUxp5B 0+J*~E.]͊u+>1t?h.5.ɦ&eZ$Cl'űRaqzmxuo0J+չ *hLQI8PUٱWf]*YYxxm&}wvHE) (DERƒ"Ȍd S(>z[-|("Yޡ뗖swu)a޾0y al*D?g5sM2gOԕ ;n,{fYDexDTl"Q~6M4?Z6r@\Hv}-'qi&Zk~nmA᷆J9<)>&U6~ij Ɓ+c1$;o 徕MN9}@ԉМKW2=Q*gL'=sߚӼϤpT1d8aюߎ^Y )!b=^̮ȱ8YW倥^-9LFW[v)ɢeaf5ڹ+|$uͨu_YNh 5넶2ڳNuyMRcP;9M+@{Ȫv,o Ka\Iˢ `0ž.VMazX$#s]I&'z.Nm#Q)^RG( ԀsQp"-Wg6) >XE5LRAU>4͞,(9f8`jKr5qWevjʮ*]]qWeWvjˮ*j⭌ˮ*\U٫\*cYUlepyDWc+N*kAsTE霙rKROsqQ]]v=Mv.`Kt]늻/ S!]ȫLUئ;6* v=OlRvvlRRW ] 7Łx(v^v^)vlUٱWcH].uS_bobG^tg!SFhix5đۉɍ7LRx]Qv,)v*IqK ed xt[Vc= -HR'rBMJvzv$JV6@ ooo 5ӟb ri]]"UqWcE.ǃ /6*!Ԭ|rK\i[;Kȇd6\[)t5RTڟX*NrMnǁ]lUزR:+F"z ,4 o+~ 4HfCu+򼦐W?ϰ[T6f,K1; pǃ\$;.ǃ\(v^*Ty+CA*)vl v8ؤecvb+.bWc!īKWc\ v**Tv*K`p+ujRX w.+^Q4$Z_[Y*XS8# h~Hˈ)^-]"G F0-:kv<إؠ]]vx=DqɌ : 4TO#A":AkM]21MRdEܻsV;-\*  v;]PUب5Weٰ%{b]]و]Wc];/.Ǎ*i r6krVgF>rZJ-?^GXCڧDvϲ_ec2#e:T}#ln#>[~dihݒG"U8M6QLU#*rE"g?[z dAmzԗ2rH԰Q@|NIe✏NUQߦbxs )#oaN^x ,[Tq=OUCu'b"'?kV.O-F7Ehk6&iuDl38[uXخv^*켊]]vlUhXI)8'dZ-rأ Kxl-PS' O5Ž8A)S hv#&c](.ŀ]i#YZfrRtE)9滬67Qn ?%),X.®*y1nFo_7?1|,bǍkvEW,%%)YnZ̒u=^#M$xP쾘UK%ؠ5‡eLUؠ5ȫ;/ ]]cإ ;KKU5`*~ ٱ*p4.ǃK{Uب8آ ]OXtذliE8F)G7a Ks^s.^ +X[sU?[N`49/V.|BIUߗ_%ɞjn6TW"# 5=G&SHrA'k w<^#M$xP*x5]v( peK J쾘ا\UxRp=H..ǃ\ W ].U| ~v8bJec*iG1!.njWcWee ;9t$P9|emg\Evɋq[ La- XȽݵ?|O pv8 )vs"K =:b_\l[Sc_a6ICHӠ>+>R\ 5̆Gx F ؖ;,m]늻/%]\K%ؠ5‡eLJv8bcWeK`Ki]# ]S\ vv;PJ,R~E]*v*~E. p4]]MΆ7pH"݄6wShwBEtaٗ/Ze(s[E[-홫Ҫ|Gu>P< LW>50 &f]m-C?=gFR5 >t#BWrkb:u f)vjf*[\Rjf*]\U]WwL]uʮ)vjf)o.\UWvj\U٫5qW ]٫Wvjf(o5qWf*j\U٫]3Wvjf(vj\R߾j↳Wvj\U٫5qWf)p\P[\UؽUܒp&FJrʐRT_j >o}W7x8=ᑍ)IG~5?LE[bE]tɗ,ރeԤex.Nx*WܵsNJdSr;ϻO#^aZP IDGS0wsycW#u5¢&m$ETĎkMijY=E~Br)j=0]]ힹ[  _So1_[ 7A+P\=h֪; ~ : VR/Σ)LL괙%O{BڝɺǩOjЃᐍ;׾n9-~! 5eڝx,D"fY2N%+fnE=Ϩ̏)3C[ q.M @<{ށ:Gi/4c,kkk3mJִ:qݶLkbKr$P!~nk7nsjj>}Vp:>myAEZFR505:3v|ޛ.]LQ;i}Ccqt,Ij>xf͜t Ȭ-iҀ %i'<]T FJƒ,|,mQGs,-QZè# Rs ^qC<$NG-a^)NLDHzBn&m,yzūL*>/}q[,r*bVlLIwZ|čߙ?^K4mUӐ&ȶm'^KG"^U$ysc1?yϞF"گ#:p0~RjѳI=M/m:c̋r4ژ}y{/<Ȣ0½hsDlluܳߓ+]FQ ybG!Jmi~d>Kx-4SzO;q|rXq$ד#Q{{3_B-TP Z>?H$wI 򌽀Id#/uY3՝7^ m4:<ױAV*j~Y!tISa pGơ@@(u_OdQ{w}>l"%!,J=Tp(#OU6jvmc˚ąPBZGd^@XM\KTi u>4$\M\4#kMUjN~v`i] 2\ئA. 0L*p4Bȫc%ٱKqd 1WcWcH. 7.Ł0;].v?"bqC@{!.Ab{dHWb{`ȥخ(v!ujIu8c*R-]߶)jDч̎lbik-~xuUJ; #v9$ Q Ks3oG\InɆc7Kd[@XM\n~%&$4: FEʴy^v=F$m~ػV퀫` K r)v_L v( p`ؠ5ȫ;/ ]]eLR~vQR쮘ذ5 (v^%])v?")]8"cdž$+l P`WcWb3b0JE ף̿/-0J-⷗}ҞǮF.mMUHeCGSHi>raHK)#4zƟes(iV߭?z{對4H.ɱv*_DWeLUU`%]di]®L+L(v; /]Nbfb| pPvvl v8 vv<L+k< ثN=} k mj sF|_ Z:\F}w?Qwd$ DM vMM'rqKx_sr-Fs( 8Ź ^TWo5qVWo5qVWo5qWf*]j\U٫5qWf*]Wvj\U٫5qWf*j*j*j\U٫YY5qVWvjf*j\U٫j\U٫y5qVWo5qVWn5qVWw\[\U3Wp\U[\U٫='GnQx0cc,4Y_8}OhZiQJ3Ҵ/|Ѕ0E d߻g9 [ F dnǿӀK拡5E#+,r:f"8z GsɒcO_#jFxxu>Mzq|Ae%{mEyW&i)VqpO]$E[U6`D{C5Ĕj09s DmGܻåMr8h]M;GE]@<}%;u~OZ&),GHu_Qs%x\t C;|6GՄ6p+8Dl(*:SDU^1Gg]c4w/S7ZxyZƹ33`C67RMGOyy K2D/~nՑQq$ӽ:_㿔de6|r5kG1/=[Ǫk>~=,e4흇}[IhO6Aƴd F8@|?Oȿ̻X[)$UI" On!nP):2v Y9'*'Ǟ(f5o9y^mI1L]O~.?]D M{C"c q6 >(vſ:6Ye͔?`1l5 Z,haRR"'ϝzJKw0,I < _,1G&m*B5bք~rPn8⻻\R3__zߐDe2y >*Waa$l4_?ʻO2jVPJң>vm~jԗi fLtp@kvlpDrW̳i ԥ)Q@gI^˴'ZZJ0찌rSyQc-̌zINn}Tl6eB\UYf*{P!Cj%FѮT|YP9,I`Z֫esAr\ #jxߑ*<Šj~=;9t*GZxˏR12xn-:VѴcQ受IV4C7[p!߹뿔/Ɣi_u +r7d?IznG÷/Xyu⯗nCznG'xg9W;+Uԋt"CщC͔qFPS/]=6ɼ,Rc^hkRMs^-j47v=Wnj@Pk22H-A tmUɡW5|1V\:͹!V#"` z-*b6{WD@98goI+Wvj\U[\U[\U٫횸yy5qVy5qWe*Z6c( c ­]'9ϯ9?CL?>0li6jS] 7]]**1WcWeLUئN͊*v*iCL/v<‡fĥxif]]]"ٱKUjUUအٰ+xb͊ 4@? ?cR 5}pcL2P܏_{a9'[-Q]sRS%N:3 ,oUxko Kn%)ӟ]3`K*vv<Ǎ!.E]!]Wc+]lSrQ1"݅.tɚҿ/ peHGډSfC"4S}lizĿSCNI2+W9ε[g}|2pVL$;6*1Wb#]®*~!]Hv?"` ®ǩ!]c튻].Y;lUUӊ]O)v-]Hv; /"cīWbS v,jX]c] v(e/x%Hv;C8~~||?]K )5;z7Q!jzM>ab7'@ ~o4<22)+皵2mb;|}PVIS͊6*UZ<] 1WcWeL<ئE.U*p4BȫaWeKKزv8b]W\Y$Jӝ(y20i2fB B{Ҹ»~NCq꼺fi왁ͬ":N>8B8Ϸ1Xf_y\)h;? ǖqc-$_&(ʘ[:Vy4`d\"kXWq$7B"PQ6},rXC7'46Mp[҇S2+T9ukᓄzHaXٱWfŁJvvX=Wc]HP~E;]S"Bǃ/ /] 1Kزv8ثث-Z,R[,vvl v8]ǃ\UpWcjvvlUSYz׈|`n{V.vQ綾o|_flrd*f[[Mz 5o]rk%uiV7R9(>yeޭv^(0h;r+5cC:`jk2Cesڜ_<*{S%  1n=)rJ ᚋsu' _;K}gC#2|[Pߔey [0Tuyk*Gv4͜bOGOr~ǯ,dڒzW˥p"Mz>. io3]G2U@{9m{uK&CL9Ɇ|3_-h_Y0 9JQO ^S瓧˟͐]nFu=omXVL'wO۝>c>ek+Ȧ6 )S#yfU?NK6{}q 9/uDhSJ\mn@쁜o{:2ł}2uݞMCf&2{GNo5ϒyO| ;8}Yv}F֗8ckdp"b'7NU&VVH;_3;Oo2Ow\y1?EyVRŸ{S&'tV܊f:QmiCK"9r}Yw9 02d2Ğkԭ=Hj6 j-h|0ш-N>FM6 SG/TS צ7IÐbj2ʤ.8l">Y)!q_/|'/2Z)BdG!@+<t@?z?|Y%8SZ<\׾\UsWvj\U\U[MJ]췞E+ҬiFRKZSaҭfԮ"s'䥫8C^xQr,=0t;C.<o{wЩ`сb;ʭP(ͧǤj׺]3Eo<)zTjimDDf@n(xƙeJ)A1\#R7\U٫5qWf*]yU]\U<]Wvj\U٫5qWf*]j\U٫5qVWk5qWcN*⭌k mp]4WS7X~VHhqhV͊6*ثiB® 1WcWe)]f]4 S"v<Wee)vlRrثإxٰٺ`Wb/v;C+ٱWf]vHmF~?aec/qՌ~x ƛS\ ce0!EO[duMF-p|O)p09LLK;{MWf]vX4Uذ84O7c#ۉJoXUɵ®c %بǮcXؠȔyLUK؉&ΣqclQv uV&&JvvZBqXŸD.-?\FN@jzd#V=a'\)RD^n(vlUٱWeLUذ5ȫa]$$;K‡cE5 B2vX8.bp+WcqKݎ$;/ ,dRPB]]LUتK`q`|%v.ŔKPqK?gP~!|rJa(vZ ,,mILӋhO24g}V޾8!jW"Y{Sb͊6*i*TWc튻*p8HP~EWc9v<UxU}p2vw{;̺ )5*@o3="KvdzX|obWSv¨ƘADPU^vy2}:Kȣpsv!(E!ǵKIԡXr=>5w\C,nT}9OK)Ҟɪ; ܏i_5&7o b#$xz(M.O)&ƌe'.1ر` FbG<n`p?V[p0&QI@ E;x~˗Jidc'z0K&3܃xǨhd=>5M K$?D{?5݊Tb}GnXő#_r$yxnkK\~EkA.nWA0'>8Yhaߔe?/#';|F{8IWӦۭ?%• K^ Sud2:"IZؙ!MVH%_0]'˩fFAą\$Sчߍ*WfV*E7Q1ˣ E?Ofo v;}i +c |C%˦7_W#M퐽[PD5{aiW!C[PT[۪1v19) ODUœN?fSF|]Q゗HnoCL#O3'@ O.oJ؜24{X_,j*,'diG[/;/؍4*U{ N'qerר8y[hQyȻ(<ҦՇݏY .CиJƷ<~)>ܟio_IMb/,kxc-.HU?` 4M%d 9`槸ч"u8-dx5].ǣv8S<* v8!]Ur%]WcU ث3ؘ[plT|rrmVMjݬ/hgUߓ!2Aaa=ܱp3ݹV*]qVWo5qVWvjWWvjf)vj\P㚸٫5qVWkj\U٫5qWf*㚸yWo5qVWu2.Wvj\UU]\Uʮ)k.y嚸*j\P[\R׾j|Wvjf*㚸Wu3WvUqWevj\U٫\sWvj` OL Zݿ+|.8@1M?*cCfi'!ua^o댉ngg`:ֶрzg5S-DܣWY晥T $)79NM?j3&׏Jh%C"Yz [`wS(ۊ¼*Cܨkf;NQLv?>!$dQVdO7#.`cT.}Mb2E#haSmuX"m6:&PBD.߈LLpj^_Ɉ_2r(>5M1$,.#}2pz#+Z7ZsH<~f~YXg_n2Y\-އ:f;g ~WU?^}Ĵfᐡ=7~DP͠*#t5v}5Oߗ)6b:{]!/w#ΟQyvߢmKy|i7i}J%PzfUB5^#|^}yx5ED!QmQj'0^Jo+᜷l=]Fχ3?4.,F~_;";%ZzܗOTn.t1cwm}L, Ρ[w78^#`^iˠLs{pTB<|sƫ>&|{[ick#0OXҞVk.^0m<kh2}%OBXeƥ n"9Q,ry~_?byd>"8yI?s|<bFnND+jd9[\Pjf*| *z q6y,Z|m;xT滴_wFO.޺<>;2p^'J{AhY _!OßNtD)im>O+eQOTV{Z{MZY2ˊDHAuAgĈPW+B35qWf*\R]\Uu]WvlP.\U٫5qCyZ\PjeW5qWevjWvjt\RUqWebW\ NvkP(ndb ʗg%wi!%ԓԓq񸫳b͊6*ثEn ~v^vX8bǩإ va*\UxPzWc*v)͊/'f]S]/1URi]u]CKb͊6*i@7(x@jdq50Kz5)Wr{a]crKPSfﲯeLR@)żثb͊6*z6=0ɿޙJStsW7?1U.U.Fv( v(r)v(1*u0+-ݛ4_5\&:6DfsmxT4ՑGP26Ϋt;x %Mrd@jv4cqCb͊Mp+v^Uk.ǃ\(v^*Ty+bb|UxRp=H..ǃ\ W ].U]ǃC*QNv,<0%ت.pv#j]Mq#陾 Aޝ_5 JvZ wɳh:`SQٿQȑirް0)"}WZPkKFQ7vlUٱWf] 0v, p+v;*x=!!]S ® E+ءk;'~hO1{r쪎lvfrL\ ,y;~ь.B9:XD6Ԋ*ϳzOt+JWdNm}.W(ʢѿ3I\ͪR3Y>*v3AX>WQ ~d7/oѼe*-̵rkg`A6C$aˎ(eR( dEqU?|(,muvI \Aڸc2?h#~+#0-TZeƫ"9G|KB '?,u RȈu[HdQҴI`7羍RG hө'$h6䃢rtKZ/,, kLZ 8G]؉>#zWM2Znݳ"ܦ|ñ kͶ::(Cr}U;sR6HE'|$TM=S\&[s`4ZncR0)JN&fYL-2$LZ`P)I|`Wd;4t 9I|f㷍Ҩ2ћ)BkU,E:zcDA2ZgH6 idF9!b#A"FGDq@0S.-pMBø)'|"OFƩ:_Y[^iM陓]>LeuRgri OcXBA;t3)t%ۀ}wZ 'Iҥ3}<}ñ{OO/+)>x4j+an22|j~WCfu%;ܨQq;ژT,XCecھMzgvcgd)XMljnmGiv:ipXѠavQ₹<~r'{69MpTLtY/dG;C/n8BZv^A䕝br93kd.YGxs!?tD/-jQpj B(l#›xBzX2CC])?.DЉtjnO[5\Yt *kOXUqm[@hjHlqlȵt0:*QOT?!tޥ>{'n[X0֠k35n۷`dc͊;L~z*ov8k_,蟣It?3ɒG钺5<\U*늵yU]늵\U<[ʮ*]L]5qWf*eo*Wvjˮ*].Y5qV򫊻5qV늷\U[ʮ*]qVWvj\U٫5qWf*\UU]\U٫yU]\U٫3Wvj\U5qVWl*X.:*5O1M| SpʸŦ3<{]6nnpozOwn5au!ZeAfnV4G~졤1|7{lGbՅu';ߕ4tϪN[w 2Ϙ6|7-e"kΘ5ӞNw+3W2>U 5 tI@2 N6|ɨEV_oNl4heSUW!mC%U &O|Y"f}^##|x>kgȢ!> Bz$W÷^s:v,/BAV#{5m8zFTRgofwxڡ"wWK/|{W6Q\g:΋Cw t%{[I( n)'ucR&$;iO2_!9Wl6:{>=ƛ%|A {gݮk4FQqЀl_/7#@KHԉFE~;g,KuN59&oK0D6LCR7PK<ؤmp;FU i;>q>k1),Vvр[ju(y^Ofs4ڤ\ur,W&w~0EyXԞF"n7bxק7X-ٟ,D4Gݍ:llb#f( >/ JFw5V>DFaed6eDenuzT27Q{9=rKMa͸9=Y0@YIۮ|kh.UOV7Z==fxtش|ZE?eȓ"\9O J̟^QU ګ^U lb+ ]l~f*|늷YU[ˮ*L\U٫5qWek*y\UZ\U٫\Uu[ʮ*]\UU\2늻*Wjk[ʮ*UqBi8!tam:T>XN61e4 #&+qWf]vlUٱWf]W"B/ lUUٱWb/] 1WcWf‡b"B]*~;6)v^6*PKWeeWcH..+S]WeȡxUxٱWf] *Yj w}r@6DR5v#S-CC[9+xhkK9ZqGCCqpkٱWf]vlUٱWd-(ȖJStsR_V`Wc!K ]/v*1Wb|$QWcaVy}^#|Ya"W-0U7n5/?ՠ5N~msjdu nDcy$Q]) #(g==2Xq&!㓄5J+?5F*UٱWf]+v8Wc+U%]eK@kv( r*p4—fc)`]F+)v, Gv8`Wc!ǏJ]بb\RXmA.l$b]^j`g8ؒ~`[\ldfk~>8 kS.JdAHٲ+@b@m1ma4cx%[4J*˚ݛvlUٱWf]VǦئv^v< K%k]\%v8m[ ?' uqN?quZ׏evW)e?0{-tF?$nc$6q~t"*kɈޣ'\9ww 6һ嶅nOL0-DޯmwX₴c/ڀ2͗T:?:t+d(,hh:N<(d(KzTQ%S n4+e!QM 3e&~!K!\F(U;X|oˀ+Mٕfd%|1fʬr;l KJƑ E>Բ `yP\:d)znA%qh,:ǥl߽5S|#b >+: )'ӮSymB|Ry1a0"ScIP4CG_(yh3mǓ䑸B=Usgoӆg8CeY9~o*bsTziF_$I*T6^ D뎲QO%l]xc?^\</ ~b3c1GsK 9Ej 4{b~^Y{3kA(˯;[Gmݛzd/2.? HH'/>@'n\0έZd'BJv8q'm P ^d:qrO/;s} M8h+`:Ǟg?7>)?ny#j|%?Gl4HU;ՕQ hK9;y[/$n]OZh)6Lɪ4KP{o<ɉ%@aU(i [45;0IZ/rdqY7!iȜ /HPHurH{Q(T$׸$ VUN#l2.%~uG$j)PjM0BY7N\ȼж `?ϢQ/ 9MEu7WrWaO`it3GB2_[X@j;s~E+.O7#|1Am: =7@xsIAOa"VBvK޴ GecL|B4t ˖:S .cWcī.U{bbnjl%i A}(}%Jz5;=}WzFt0p7(f*5qWf*ʮ*㚸Wvj\UZ\U٫5qWf*l]Wvj\U٫5qWf*\sWvj\U٫5qWf*]Wvj\U٫5qWf*ʮ*]늸Wvj\U\U٫5qWf*]Wvj\U٫.5qW)?P}SiORCV̽ZPu-)jն?eF窼EcpfO?|fJ=0^||fUvf&y\˝Px -7JT:,,s]/2WxA9`Djaid{噪"m={Ê9&H=h:4Z6ub]A!Ozaƅܬd5=MvuqJxު™4mĴaČG("Kn9~uήq!xlqǝ<T(F%aI2=%Z'.m2)t|vw_[Dyd*hKvQ.qrGAcjTluHaTㆶwNJ1MgrZގz׿ӈ 4ۯ'qv˾_&P%'OW}Jkxf$ƫ_NԝɤN\"<婵-Bm+k Z@3~{Ƨ>#Ei2D,ts %]h]%bVDcq%~^]kR6BWMy;M6k䘖i {VE?UmH;}9~W &˲}X;rw19 g˚]|ߚ5$wtt}Z;FPmMsӛ8#rKN:]./ $vʴͦ,$"]SCGZj W/F%=3AʝP6SZ+ȴߚlj#r <|5}PgchK^$ȗ|'.$o9ÓҌzd\R;' ?X?ǿ5 `,l`˰{oI-6QFe;ߖO.Hkv[\ՋLi8ӵ{=T3,vn=U5qWg.* J][%:jJ{Sfd;A}AWTD'q-};KpfVѥӔ `Hr!;>6F֝_0ߝ·mrM^_>yιi~*f*]\U٫5qWevUqWf*]Wu3Wvj\U٫5qWf*]Wvj95qWf*vUqWck\UpN*4d37j?xwa$/uT=d3b͊6*ثbv, r*UxUk/v`i..v;vX4 \Wev; /]b/v^)v^v4RRQWe+!xUx!D]6` 3XuKg}|2H9ŴS]u0?tqB?#Ca4ZARU؃q2Wf]vlUٱWd_L?I^,Wcؠ!ဤ;KP+Wb]vɷ=#h&}0IX_>.F3Sa K_[9k+Xh=F!9t` t- ms&71eB(x}\n̆=r Wm-QYbn*UٱWf]W;+U`v?vX4sWb,aWc S"®f.`v?vQ. 7.ņWcdžؠ A5ŀb. dB_=14X o5>/ckYuXZ׭; ivbR?U}L'bvF?'c㖂ik-~xi}f/@~dv9,}3~>9,s%L%X;6*ثb͊V퀫` K r)vX4b  1!]*`w-ŦJ< }eO F#jsbG ._91`MC,*)᝵_|Ny]gyW #oE=H^aHuBZP_e0N n8]ᐥQ I*jO `9 mj2MrQjw>E<^c)DI,[Rӫ!#W KD`빭 rlJΑT| m1JtqP)S0jצJ@^ԅfڄw̼yLz6quU4%)PN Sqd#{Ja !1x4zæac󄮨B=1#mNa ikpNL`,' 7rrf!YWnjHvk|ӵ| n_ScSl)!<&I?+?s2yIl(oFTEer}Ry>xvb><*-O w ;nI=zQvT+ʸ OM]cn-|5iUP7~10 ܘ[ yRa!{x!)#aItd;ޕc=6^eT)N-?5 #b!ۆ1h!-Ȧ!DtIIY>Q zڗ~{_J%Rxp+}V3n(ۍz9ÈiQ$y~87ܗ`a@"xy=|32RD KRF׆y27S!*cYE_5#Ut5>${,%f43]k4''lbd{hL^JSFJ3gp ._1a, ;W«哀&T 5۾Ac8y Ş0\Ly6KT0M#HPf8Җ"X s Ol/)ΒiwlùF^vAIn$cm#J\0h 7Ž Ͼ\Ea2^{K  4n~!O0|r1T Y t w 2-w`{23՘Gr/S(}??Qk'| &H~fY/)?KݼoC1k s՟;n6*„$Ddr,%Ft |Y/Łp!*p8 ] vv!ut-ݎb#jM;[jә|OFY622YcEqT to!ޒE$ٸ`Y #4̘xmِZ6i8f.84ڊS͎&RY K3-[ګ݂l0!a sO]<I?fggF,@js[[X *90r]=|N8V6 9+\|pjhf#4 5'n?oy΄\yӝ ~^mXmo@d?? P5u=FM |)xPS̞qEh+\ ~L 喫w'Y4奸&7sy/Vo9~GP$a DDjI9%9Co*ʞ+JvѬӒ 3܇ZLgIlFP&n/6~bO#;ޤтX*Ad94NH ~ԧ*S V5\w,*tf-` ,#k"Y%$7As6 ysnس0dO_nQ9u,yOTkkV(E } 2vpjaP;p}y e$dY@kCٺg-?1*Mv:9ˮ٦vLR:xi%d&o:5PۢIE#Z/WIR2'=~]1Ǽ_$>n/0" և>a̚s%ԓu}44t}G ۠ (09_Heԅlmٰ{I卆࣑BX.`11+Ώ~sA*!yZ|bz9>?ûdCYҞiIߙB1E҂p:~5R=bymgR .ir7P:Zg!2{6\CcÛGR=|:qj.ddB=sZƏy>Ḃ츥GeBbb7]{[e#{3q/WPҕ+=,$Ƞ~Ua2 -Q|{9]]3Aܙѻc7Q#cSN^`U|?ڵi?ڃ#m cu@U- ~2s:c`- gk1~*]Wvj\U]YY5qWf*]yWo5qVWvj\U٫Y٫(UzW]\Uis1S9ђ5->XAj]®͊6*ثb`r**1Wc] 1KL vlUqWcWeL$Zdxv^;6%!xif]]]"ٱKUj*v*pB vcmL=o}^݆IKr50~3kTǸy.YHSGcy/_|,+R#lyEu;QGK ZC{dWcpb͊6*y/1RӟJFA`ȕv>$;Nv,E.ŗ|RJ!S#tƭӰMRzV>-0Ƃ(M.x{ ҐNDYwsE[ /v!<"U(tFT]\\r{uڅ(ۡH,r٭\;6E. vlUف`kG]lUAWc;diWc9v<UxUxi]œbʦ)v9M1Kq].E]$@KUl%زb;Q~Z; `MJzR|\0MpP[8ŅƔ>YKT8]k?xFW"L2+Ke8Bc*Av/ǼOR q!,6x{erAjz?'eЕRbثb͊6*UZ<%v? ,byL] 0U4B>)~~Xoo67v4A*tQS!5{ww9'{ǫ7t5 ep?#K,onpG^ +|~T\hyj*$_- H(W3j8r#9kYdPG܊"bPoL̆%djٽXUڠ=C ;dd)U֤ 8,% *d>-s$_H3t*W.xMI|SNFQ,B<|2Cxk1(R#flBUc\Z1(kC}󊜅P')fty{`qeF>,잷D%u8peA3t:f$;E8#b-qGHu`K=*?~:{WrME:&%*W%$lT=i'Z8ʓ&{ht)gR{(.$`I݆޸ƵpܙZOqX:u$#e 9Tf^>M#̬RB!DRxׯ=8֣2<0:H|=$,*w3*_15qa)q%ED޸~~s0ҙ\-'PA.u 㲨̢ D[ 1h5hd; 6͏K’?%ZHu˹ v1h7H:;FKkTe-̟I zǘ5-nrYbNlUoQ~ l2Ҟ2J1D#^F\\N8mA勅@ώGmM6,P#vD|8U>v+\% unzk`EvxD-;qݼяcV=^sam 2)oQVǒFN I//\&=L  -*h: KZ{yDt-t !4RXcM$?K Hy$#^kt(|A$pF kVXfyKnH!83c0iX`v8-P;03Nw!mdGAG2Fᑫ)q9vۧ3cW_k ڱ:1E݊{f[ᓈۨ<0i X#v"kmN"E]JQeUGvOLk_-rR"B7.(!#&@vL٢y8'.\f`C]OYO$)?7YyO p?sZ~~АV+%v9vGhO0(G:\&g~joqלLoc.p+aWfȥ{bUxk)X*Moȍ6SW.-3q9--cmEHRy\U]W5p٫.\P.\PZ\U]YWvj\U٫5qWf5p!٫5qWf*.\P.\P]٫U٫Z\U]Wvj\R]٫5qWf*]Wy\ Z\U]Wvjf)o5qCW ;\t^NȰ҇c$#KCd[\]hhh>hX4ح\٢ÙF'7~^;4[eZ,¼ɩ$w9Hյle%&}aQf^ɪDey0[LRj楏qhaq-%~(In mޥeG'1ë&kWvj\Uek73ѐ>9 TQةL|EOCÒ/gZnp^o>'{ j4Q3c̸Rt6GrAqo鲴G|3tk{Bf[(ʃMw6&s%$gkbL00!#'!CM>=6HO^^ #N>\P]٫Wvjf(vj\U٫]٫]٫]Y\U٫5qWf*.\PZ\U.\UU]N*XlUXbIѡF )_鍦c;ۣ{x|!ǔiT)&UٱWf]vlU4 W/ 04]])v?]v<‡cl+L7LUk]ٱK{bKbef®fWb| v*ijr>[J&K,c~
    '#"W Iv.K`{`Wb`+U:wa+; [3nxRadwQK79a GC2mo‡f]vlU`qU*{b ;d{aCUجR4l ArK[Uy{ttKP>j}<\5.(d0|{_1[=®4'C,mONp\QO#I؏9oeӒeG"?K~=LF^ A,{OV4#*sN5' G$ivGKXA u6LА=l1LAO(ϓVǶ"ZsXq%FAo6,%h["ݹP[w!$Csc+ȜyH5 Z8Px@C(HS6xe{9 .Im0Ol^ 4R#F9%p֘0Iw»S-Q=^%qܒKq";Ѳ.̦0"VQ7rq11=j2> 6bG_H-4J< 7O (r8 igEvF5ָ Cf;xepDJV "`Mq% ^t).@WDWݙ:b` 'nX wL¨CH\M"ĞL$)#rm#(%Fu4|=Ku2KpЅ[[0k^$O5H>;aB teA>##[=ڥw8~%N fխ̈9:8n"Jf;_`aUv7,5`j*;qlq,%,<۾Ksu*ɩJcU,@ AʞrTCF^N`B96IrC@k cB1Y 2~X_%ӥ2NVZ?Y pb7wr9tz`qa$w̟o0[VxHcjg+PxAmP*Tc2 VbjNͧIqC0PV-d_B%ʳ +0Si}O)i*Jיա *?pK+H\prJ1m^iZxӴnmQPKhlsZ53lAXnB:ajnv혹1}SSE£Ԏ#m1 'їG23YF9;~Om8m|8[beqmU {}`@M9<ֹr} C2(eaa4EUr;wSnk9#i{v_a[t@>5VTZ,~ N} }GwTWTg \kSM6 aܧ hTIG$dzoj}$l'X`!yw۠SLzla+ɘ˭mꅎˆ^8ӹOA$L!X Wę= UI!]5̎ϗ[绢d<ɟ5ZZOotU&ѬnfE#!bibܘK[u`2"f(KL p8xK y{V54P; k&vAt! [C;r>k\Y,ˮ*®\ ]Wvj\U٫5qWf*]Wvj\U٫5qWf*]WvUp]U٫5p+Wvj\U٫]W5qWf*]WvjWfvUp]Wvj\U٫5qWf*]Wvj\U٫5qWf*]Wvhfi5"5Ӑ0bz8!U]J>~XM~iZ]Ƴ Վ̿A:F2޺:}YcaL_k7>" bEPt&S0WQb%&jVs\ZKC#Ԡ?ܳ2  <.em~J֭֎øaHV@5vڲofoƹ:AK(՟b]N)YޛG57$hg_ k~XU@⩩yB.`M`枷'=Ǔ3>V,tO:hZ$QuVv$|ϕaX^ޗ3 aS@γ>:N&#oMWBCj@  Ԭ`?jZ kS)·pr~.ygEڥK*E6.B8O5y<T?rI؟:,x6.V:n6 >/<+[AaDT(ߞGjzX0 }9ݡa 8ޗO8>EӴiȞPyʇ#<{AǖgSǒfg1˭/ʊ|`$^AIx(~XEm3^]j~y$xmYQ|9%9D,4hcUP|}6ziF"e!vB[ߒ&[3Ui WanŜq=[tJ@~dASNs?RvE[ nHR '񕟐+O c|LLF3+=%vF{ZH$,AuS3CKzA/~J^c[k$S4$wɟ?=k!rUn:Nua@Hqw:;GbkS=p2M&gp$&ԥ+_ /H~zyqSZ "zPiZÿ/͹߬]J/CLz">gh4NQ&|no.mXI,ֱKB |sb=5qWeWv]pW5qWf*>b8$t^,z˸)AK{ ,!rSL't 1fyLPSV>P>פ?ߚ+ڗP$ic@y(|/#Wܕ`&Xu+s}ҽ |Ra/X/>Nd3dʣ*s7|};4I~9h?6M, u(͹D|W0dfj\U٫5qWf*]Wvj\U٫]W5qWf*]Wvj\U٫5qWf*]WvUqWf]W6*+vV*e {Z嗖ZH:db)S‡f]vlUٱWf]+v8Wc+]]v<c%ف*~*(v=Ol ~vX4]‡f]bǩإ إxو®eC]a 4"U0( w>$6HS&2'qrZI+"?ql6cfP|p%ؠ=KN!]mpֲWBN]}OכDMv´V&m9mD<7p.lnvd jlЬѤz3'|TNeG[_Sw+h5"@ɹ۠&fvhjTt M-+ oB, WV5ڝNo47'/iŔe)ayǪbmsM(/^@dG9s1Oupdlf᧾68V%- mIg%%%mRFDHގ:vCa[wMw8Ņq$r_F cͽv|}+jl%f)E:0j%n DQȝ"N,VúAK;*QJe`|{Hw[ۏG !A&]6L@ét& Z嵌A>4Bτ&r4dZL$FZ*; !e#nKb[x<+O˫j~!QXc\+N"i -޸di~`z ӎL$=e˗,* -2RF׎[9dIA fh_RDSFa?Wb05\6vsė *Sa{~S?X ƕ\GgrAk3_r05 5[+fy ay]N4Ke(%*N\|&qt&m90Ͻ!u$0u *Ԧ> 0 pC:9^7 ?y7ǯ|pTzB]8c+!vt"u|!K%dUVۚNiwQ _ңTՓ$G[ɺr4PU9FIL6kĵkOטygcr4f΋/0A~_lfnw=V$xNH3jV1lqɌ}q4iq˩yT_ZFcᆩm"5Bҿ7]]~lpTa#*pRe $O|},oTp@7=>~򶚌@xkfCkt]f['.ZiZv|Eluo0_j:7,bs Ӵщ.o0đR2FdjRYZ< vv;eT;/ onkd$]I}n~ d#J=~$O5pYu\UU®\Uu\U٫Y5qWeW .٫]yZ\U٫*yZˮvUp]Wvj*jk5p+]\ vjWek5pW*W L\*]p+WvjWeW.]늻*yuf*WevUqWe5qWeW 5qWe5qWgT.'Ps5j1Oo7I>dl{QQV!#RV*ӮyؾҚ>/ǛV95O%:+Zр9-km?RoFpOs+Ehjeũ`;~yr[ j -玼We/-knLq@'=vx):g_n B>lDvqGѨQgjSZjˢRxOn?ߑֲG_/Ә}@7<p"e6%ɭ4eP81EhO?*o5y sM?Vkzly+5'Z#^t4zp<ߕߥ5| :ܬ7,L=+y_Z5234BW2Or+gG)cD_y.zr~BF[H ~ѧsѿ.-^G|ysh|ߟqg9Y/$HPiƽdD5GK͟.KRROC]zռb°.e0evJw`&kz~ HeuHʐ]Z8>'KA#m]ί$m޽;]ŅH;^vHH9iFovIX SfFCr!~*YW֤R]`keY>jPZq%*b+^VռciV'sLo> 2ȥI$d[~y!Σsd篥!Ce"^X @=F}]}[\{1JX _zWk9E, D=ΫèhSc|AC}jz}΍u.c2~p04^oqIse#yҝp+W 5p+WvjWeWo.[\UWeY]\UeWv]qWfo5pY5p+W 5p+]٫5qWf'vP8P]*}0Zƣ$t 8 Tep1N Sxp+|RQN)v*)vf^cn-&oJO -ejzzjP_fx, .m M8R‡f]'?〶cSӟMl~bL)]Pׯ\ v.v,v!s7S$ v ҬiKGXM۶/sxd[U"Kv<%v8HKǃ\Ux (zUTy%҆ &86d}_AuNCK.D6?h$835qWeb͊6*Q[WeL*~*p9.jx5ȥ}0%ؠ5‡eLHWb"LP~*)v8`K|Yxv*0%xaHv8m.IQ]+  Y\F_ד%b:c`w%WdddTmE$ذc{Wbݰbi]bt)FO7`k97eM\1[}m<1Gu5GW@xs@|#ڒ>ߙ3Dz, :ڀO$: 7na6;urƼz/o]S]BX r5̼] uV0h %g ?^[f gv8c^) "+'*K cem4ubA,Z Tw~gv^(A[m@t'Ҋ}ց ׮[7$\~)`G#1ו~ELr~YB-Ő˛0խ ={5+SCf1KhH,倯&D+ŭr3>Q*O+ ;GC+to~ ݴ1jzA*ըY? =@L?Ցp֔c.vm\a.Nl]=wdoge!-KXyhTöϨiOcq*mJH˜wgL ׾rr~clyG%42PX]B2Ɠ!^k`X,G6YXzW ?Pᘺء;Eyl.G*=>X*mwOgQ#>>yq3E%>jPCcw$ԨUJ)SާlzO mNR(cg%{*@2437 }dp%וuݢ $~k>EGV1@5tz/g5('>^CI5sƒ=9?:u_3hʼn) W؝+=-G*'oICGGZվo,L**<3uߙ5Eı 79NM. [6,%,df]/MI`c(4VvQ2%Yj$n s2 .'mAPæhOapc]a~swXdbidsi0~;vN͆ K1^;b?~+N,epE;#woy2cd81h:BW#!-uAGSLbq Pu _1Qon)<1A!r'0>L%.`;QmrZzvDqq Xu.?17'sra8_=0-ߞ517, tX#I9p?NTr=G?̾I8ԭQO VQ;Y5qWf*jVW 5qWgB˾pѵP^Fx`|RgOUN9P9ʚU4W<DKBRt/,Q,)W0nMיk5f_{H z L.)oiD(enc= ֿ;(iDPy-{[<1{'8+Cj~S'aDu Пtӧ \IT4ᘽC,)\F=rBZj@a+?14<*hls"YF3\NWf*Wf*j*\R\U-*CYU–j\Uu]\UٱWf;5qKW 5qCW5p+Wk5qVb8[ˮ*i?0>7w?G|Ak{d4.b͊6*ثMWb|/v^v<]b0%x{bbyؠ5+Wc]‡f.fPk.͊/q$ZE2.#"u.dv9 ˣp%z,@]L ]%ǃLUب8ؠ8ؠ88AAm>\>4ĬaMt (xswC'~%](8 f59z}9L76(oK`+.Ӿ)WeI {Zafn_ԗ&ZM\zkhOFvS"WSȫ]]ȫ!.LU U؜TaE\5Nчˁ EE0uFȑMv=rfmt"mBay$;6*ثUj*~vX4]] 0Wb,aWc S"cc0+aت%].ǁMKD٤Z=0Rchnԓ4kYjw?ݯZw̍EZoK%T]\Uؠ8WbWb9YZpp%ؠ8ɡ/CʐE\ӓ쓿ik-qbd?H4RQrQD)ɱvlUٱWf]v(]DU`v?v85v<Ri.:C$+QWeLPS0;],\Me+Xةde-\ ˭{zzondP^w,`=+|Glkˡ,g~v~SQQMϴk:5Ț@X9!-س?17/O0[kh GÍv nċșh YŴe1A~[~SjsU%V;ЏGr%T3$jx!;f~s{IaNaXhG j>vĶfD Ei9?9*~0b$"4e_vX]yڃDqc#nF:~'1N^G|4Q*Ewi d*+ASí ]LJ7`lR\ R x.Ě 4v ș*6 _LaulhJo!d"ZZ rNn-=1"Ҏxam^( vO4N }YG-]E^#WJojL 3)WM;6;1A{ߤ;$QfN$}GY;Kd@cJ¦i۱E@P7/RzGjGf)>&g|%HtڧVj;[>N{n-I̗~cvR`ĝ+\Enx2R4Zd ;pr|17PAywEN*dPu$xcys)4ȯƢU`9Ζ'vMAB'_&5RлAorcsȒZsl H)'M#0vdbx>|=p l:g xl\hWyo$BJI4g@=W^'W2krHl?5ϔU]Wvj\U٫ ty䷾يʓFT HTQ DOϸM p݃U'EC9Z03-W8jY;wiA®œPi]*% )yis-0281"o` ZC{d&DIvJ</lƧ/LL \Ybظ!^zbA ^INπ haXD#|T2iL]r0ı,Ƥr4֫]Wc+v8`!]ǃ\%qWf] o:d*c!n闿Wckqk'.;uWCxtn!ə \۵>#-H1UPثbAv; ,ثY;,P~v=Oc!]`Wbnj*vclJ]7bˀ`+] LRT8Aɺ`K(b{)4+땵Z[iR5` xx>8v<`K@{ǩ퀫e8YMr<ز*X v*)vd%[1v>ГjĬebm2R$S\W?,)v!ٱWf]vlUزr<*i,a2, 0*r WL*pIǮRX ;=891{mG?1h$GSf_ك]B)13orMY-:Csg+ךOBxgrP@nk饎7~a?QDLhWj]#8It;FC#iyB7׼1K4ؕx?<]/t{-vmӝV#Cg.:/7y^//uĀq : ֕R-!|U[yZ7J sV+bXn pE=:V,Y1F|r&-xje%zí%ju9DZ/Ӎ6m2/~(xMʑ#h("pɒHy|{@['_2Mz#^ jcJbG[|Hm8N$gO&i05D3>}"Q-k$uy- \Z~'>>vky"Yl|ϤU%Z8'|^ d~Hgi|זVQ$QE ? \u#\\I+LIbOrN=9D9$6*i]]*vv8ث؂Y;,P~v=Oc!]c]]*v,*v*n)vna[*BdfG mAS-#X!}msZjVWk5qWf*]yWu3Wo5qWf*׶j\U]LZ\U5qWf*[횸Wvj\U٫3Wvj\U[\U]5qWf*f*]Wwj*3b\U٫Wk5qWf*]Wo5qVWo5qVWvjf*]Wvj5qWf*[\U]t\U/1[[vU;uofS3p[HQZP8|ݢ:̭o<5y.wj7:|X?%x$Ijy~ff2D_W=RcIhT)u:"uXˇ;D +chp\۴bbO9lFfF6ÍV"rj?H{WfVelӨB)!nO>'\~pz.Ӭ倊I 72CRԨPf, h]Hy*HkOll CN S ݅\H*]e ,Z6wL$ѐ₭_43[1(18U?쭘6g~[HOԕt9914C-*( G2=r'pC!mz<gu܃=ϖT_#m5qWf*]Y՟Bլm Zg BM:k +,.ѲzOӋK`Ճ*08Wvj\UlZM #Q23$I [yYi^ קL嵂*K :SOL~tvɫɰT -Yff4qz9FŒ]VgheH'(F4HШ#sMo-y rkgxEw'aAmV>8/I㗽J]NK,b3 y a ř8bӏ:v. ڌD{|nLG 儈bcuRA,X8 \PlU٫5qWf*ᚸWvj*j\U٫5qVWk5qWu\U,[\U]yWvj\U٫5qWf*]p=Wo.[N aBlxtoFHQ@k8Wf]vlUٱWcnWbxU`v;v^*r.͊ qWeCiBȫ Wcv^(v^f.)Cm]IGじ;d-&Qܟ rK\jI8Ih2,.ǫSnث\ pc;Sbؠ8ب8#,r@\>U+FI6 :ޕ=H Z' ^ qo+/|8%qӟRA]$;NbmӰ1Rzd0=:p3dnyw2jSa®͑KUxؠvX8Wc+v;6*wozu!.$t۱pQ? 2d2ePQAu϶ie\ r"PaB2֧bgv7;6*ثŁv^v8a]$$;Kl(v; S^)] Uؠv< )v*E.WbbغũRA  1; ݗL03TbYIܜZ2]0%kؠ8ب9v*%.ŁrWbRT TR/>trJHSlf)z| mL&G *V z#Ʉ6hZ1QmDSx;6*ثbUذ5dUxU{bb ;dp=*Qc!]`Wbk ]KE!ذۦ?ŏkF/WAK@_՚/h;>Z'4N<{?_';6j4ݓ`t&7ߑ 4Y -/"56p|Z^>O[yw^q[˛fqD"k.wG=oGvݟ޽O b2] RV ui=;~%'ه}t'c_J1uo}uB<,ry͌9U7gQ&_?^s!v}SK%X O[r7X7E˳ܐh_OΟb"}EisooΝJޙ"&jo99}?Fy>Uu30@][2o6C7r)V6r {S*6}Zab-,4-R"I xp(F{KqjvX-YAڄ{Sکm(4Nh u.~U T/<]%i>RM{N;F#]|COFc7vx3<=G71߭'#5EOq59V8{>7^ٲ,Az C\M=O^3a 6q1j<|x !۱ GbHճ 恈0R$Unrc#^"mVP~#1Ow,M0>Œ:l57J8M[`m9BUַc]͊6*4Uضv^v8a]$$;K‡cWbk"Px5].c / p+*ab;4m2o-|v26bHvn_,1,*j [\U٫y5qVWo5qWf*ᚸWvj\U[\U[\U٫5qWeWv]qVWvj*]YWvj\U]Wvj*]Wk5qVWwj\U٫y5qVWo5qWf*]Wu3Ww5qW ]Ww5qW{f*]Wvj\U٫}sWvjok5}CS7@4L9S'm=73Hog͟^N&5 Qe3KJvW\;\`7ŧ2mڧpTJG1A/mk$pOS^1MһuEK#we`xTQ8 tةqOf CFya3Q8+T\ҳג5*<1WwOA ۦ*(~_ɥ2I"orOӞYkq,1#d}9sgC/׏}&i/( Ȧ;{.{/,YٍI'rIHM{ E P; F\U٫5qWf*jڏ6M'KvRդ5g-Gƺ")9k5,XքϛR{l i75 I_jVb@T*\~*~b'_喁KĴKkRHo~'"⾋\Uf*Zf*Ynmc!kFe x`;&&_1KP2M=~t[' 5UxGf}Q<ف#!)ESZě=N9Z0\vSg>h`tw\47A[Sd?)hZqVpڣDid8Ԗrճ3Xuc.ak aPz8C^ { HU0?kPc}].\æqn$[t9u\13GiVֲ<l])E8@5jNqU5qVWvj*]Wvj⮦j\U٫5qWf*]Wh*j\U٫5qWewL⫲.\Uvj։B`cOZsڽ :E*aM;6*ثb͊6*Q[ *{b͊ qKv?v^;Dv?,bCbجqDbh,vLJVvJþCS#<KA6 e (2 o,!.t.ʮ*V6q*W p.ǃ]C@qK@qKO(qWb۸i+F~$ag`?~Ft)7> Zc.}9VA'bozF$o"J߳{wcCBh8U-.Fl@2=r'd3!J`[+ȝXNo_/,j2jqN\#+ZsN\Sp ~3A~\Yh^<V-5ko"j_.4n}9T|?Vt8feHrb8?gt0Xy5]eAPFA0K!Oo~YԬ@fA\1E~GXi.͊6*z68WbxUk/*P!.c;v( rH#+m$jjjHT%hY pb^ᕉ2\%btbeJvzbj I,^d^uI5ۥdj׻#A⽚u8Gy-]dI|,/Ө\kq}tIdcRI@vxEI9/˾^ӼywkF#(=XY5qWf*]YCgMSʳ2壻X? }ٯƈЎ+_o/i^沕+Q+9XEtPIh _9b/ghb? >tm/˫2RhbsNAeH4#>u.uO<]WvUqKLyBٯu2&h7d^SQ'Ȳ47 gj7Nx'j;Pht)DV^ P3δk8}kuy$A'"W޹.48⒛o_WGuQ"fч^-"#i)o\ ]3sXMz>q8.TK#7v5>nˆ`o̭9o,jv0Dfƀr%=9Mms,kUrѤ6ph>vvBU-v$n;<~yo:7'1q@ ϘC%opx8!;JE>ThXi5Y .g8+,=AQGfc^@!1'v\GŐ4DCѺ(s>Nh {f&-|GCOlu~f'ٺ-Sq@f3lZ >?~+|#j ֑Rjϲ>mx݇wnL|iZ z{!ړe%Z7yFU% ) aNO/4pdi}sC_D-&i ~ee TGΧΫA=8R>a,ħʔ +?mjqv} Gm;Wl8ʋ?9)i>ު4܏_I-DJB;^Pm]풄HIFQ-Dy/H{FiՁfPxF,1aB%!Q <ЯgPto4!©!qnngR=%5Q2hǟ7aHd:}bE}FSljQp]0pVXKL"a$f.33aGWY+_?_殟%*]д.VPX-60'.]v}I9OV]9*2iO>-~`^럔` 1HA*W?vY6o4;pyDx{$bhx {Pij6~ <J2jWaFMWf]v(]DU`v?v85v<Ri.:C$+\,bcWeK`K a.?8JcSv%Uڢ3W;*y\U|ˮ*j\U\UU]\Uu]Wvj\U٫*늷Y*Wo.]3Wu3Wvj\U٫5qV򫊵\UZʮ*\UZ\U٫5qWtʮ*l]Wv]qWf*jeWo5qWek5qVWhf*5qVWvjʮ*LZˮ*]ʮ*]ˮ*\U٫.y5qVWu3Wvj\U٫fE3GF 5EJ?#~%lJW s9:.8_r;M2Wтq6s̱:ǒWg1_LnvNb$A!k*aLy<!VV4Ioq:lFhs k12_f~NyYΙm,G7W "o=s*C.WvUqWevUqWf*]qVWk5qWf*]L[\Uˮ*ˮ*UqVWo.YWk5qVWvjf.y-u[ LRF,5o?_Ǫ{d*X WbPثb͊6*i*TWe®ǃ\UxLUخ6)v8ثثhv( r Uآ [EiS}|qnZN7[ԫ[8߶GCˣO\ŁC%XK*f)v8`W`k]"c]]]]G B[\pnYRS|\o]bRmf`u&"&"_B/F1dJG$N 0+Dw—eMK`kvXPv *i4Wc튻6WcB]x))Fi[/va2𖈮]@}X(m{ 6Ϸ=)pPUٱWf]WUUآ퇚Ȳv=vv*0d v.v.*\ v(6`ko]`u$ hf.G_"ZQML@`+ #,bbp+c%`*S]\Uؠ8WbKejHWbثu8PU؝"u(ʔv0'?˘ͨZ8)$9OcOHя& L-1vlUٱWf]v(]\Wbv?v(oY;o8Uتm\Q]`KA"jq &<EX%;tƘ.# ] 7.ŁအB6)v9X냚>s5hpCZ5'rk#D~{ӧјQQ?y{ƞR8>O:imm+V!!Jsv#>i3,IMj@\v Ye%u+2f7B`.LRɆjj)Gj)"A~Rh?^[W骦KirSb;5QG "jb8Ȗ?pg:[]6MBvK_&{gΣq Z)WSJy GTW:̋,f0#8"+GFTW]\Zg,HPn(vlUٱWf]+W#]®jS"` ®)ئ;lU*KE~Qɂ" [T:'wUqW{*Z\UZjvUqWf*\UU]Wvj\U5qV늷\U٫5qVj*]Yu[ʮ*jˮ*UqV늷Wk*yu]\U٫5qWf*j*]\Uʮ*\UU]늻*늻5qWf**]Yu[ʮ*Z뚸Wo5qWek5qVWhWo5qWf*Z\UvUqWf*s8c_M%=#r拴Tw;[yA jPtzSw>YJdx0 ?jpD);W- bFefgġ )۠'= AN q6Ւu#plBlID8lMRoGo2Y7׊`c |&c( 5IW :ГXprڟ/;%PLWnM|E3s5׿aWvj\U٫yu]\U]qVM^۞2GbAC^Z{wr#)PȺ柒eD V}`w rFÓ]ç_~PiGԛ*79{^_ʞaԼ:X6߆uxu#H~y̑y˚_HMw,E+`r.y]ʮ*韓VIS &n ^8;f.\8|ϝWiO goo7̰Mz݋3~ڗcL uB}_MiOm"ET9r*UqVT~kߕj",sxd FpAiQnÜ6l5RHTCCQ>uV4)^e|z/3aC]|dEhVFzMǐIV#εҿD;]yU]Wvjf*[\Uu]YU]y\Uˮ*\U]\U]\U٫5qWevj\U٫]\U٫e\Uuk\Uzd/Y>޴C/OT8lSx*ثb͊6*i`p+LUUxf]C-]*4(Ý>ݸhlEM0Ub 2hz/#ɰ*n*p5///(* v=ZLRPdPP*T Q) 3bV1e.fn+RM0y0עIòr둩55c52HvX8beLR[vX8vvl v8]ǃ\Uiv; r$%pWc+bV}d*c!n4K9uZ!*٢;{f7M9Lp5Ȅ4cmo*n(vlUٱWeM*XWeWcآa!!بȥآ{K@d9 B]v-Ff? [D]N-[VYSS٤>CY+ lUURr1K\ prCUxp8  7A.Uب8زy%ز)v.v()v=T:&2\GĬa DX(!p5mձz~r`I‡f]vlUٱWbyoaWcwO'b"b]®œ!]Ȅ_|UؼQX*-ing ٙhri(x d2JqWcWcH.SLR[vX8vvl vI cw|y-^FC$H19%ڞgD-8RhÅqPt?<:5#j1]Ƌĭ*y|ȡh%Θᯋ8$G?&yDen# O[QBQ? DTM͒(˚ڬ J >]3i9)3*'ޠe%{:0}C}i,Xu*ףZ筿#!]6}kM䉀JЏ~1uݔMpvx2x[qF 2-RP)wC=Vl}Is1ÉW1 9ѽ23gYq·G8QsCӵ}GYO\U';kWNa}@3Ž_7'|gt_M˧n/DtƂsaM0lr;}f7N9 d6 r<-ߨi"v7;6*ثv, wv^v8ث؂Y;l(v; Dv?v) -r$@.A}ㅼ P$-\U\U٫5qWf*]\U٫*늺U]L]W;5qKWvj\U٫٫5qWf*ʮ*\U٫]\U5qWf*\U٫.Wvjʮ*Z\U]Wvj*eW..u]\U٫5qWf*]Wvj\Uu]\Uu9U.\U٫.٫]*늻*늻=K8棡y0jp4T'/ rswr?kP2=jXqo,% kxf7j_>S:}Ee8w˨$ lxٲM"Ɵ+MxU\Ϝxh[|9JpvK\4'E>ts(<,5g>ת9s2i^zX qmnHGskጄvA~ϴ0WUֱy?nFz \\p_٫5qWf(vjf(vjf*jev}y >XWy1bPvZIF+AT]R֧w[9?o$A/FԬzZ KДoA~Hƿ__'uKFoO}զu,.1'Yȇ>@NgΜX{9}s)f)vjˮ(vUqKWv]qW|򫊻5qWevjʮ*]\U٫W;5qKWvj⮮jˮ*|\U٫5qWf(vjevj\RWe7v]qJu]-'C „`O6 F0wV DJ JcqWf]vlUٱWcթ逅v)]] 1WcWe)qKثv8ƃWaL"Y)hz/Q6uK2%5bjNZ-~+\UX1Wc/v^)v^vQXQl x8ؠ8ؠ8Uب8;v dNNd*8 2[{ .Ll ^6²ōO\S]y*v,*v*n)v9ZbbvX8CUٲ)v<HWe!]dRx8U ثח?[]H;ib>p~1 +i`K/TiȃH]fRlFZa.f]v9M0ņ]ب ]BC`0%غbb0Bo;+uBHQa2GM3l1$D a)R`p8ecv_\*f)v(KL p8CWecUi]]*UO|RXv.K`p+@qK>d.f w^H6Gךּ/N&$.&oe-xb͊6*hkU_ )v*1]X ])v. O W`BHQa+eN^$>K> ;d@4 `icdp8ثjlzbbv8y!xUٰ%p]u]!?7\yjq۞+ԏqW(Ϗ;>͞=9'<lN8}>?V}xB\z1N 9z9|g}p[$GOëؚf9rF:d̷dFX|.)R;d';D}b@i\ [u;P`O)&wom;@YQ|9D}[)sM7[C#}{%Q^2S{>Y_h.AStyԧ?_ǿLQ7Ӷ_zzdAH.Ȼ)RU#-jv0cqCb͊WbxUkv<Hv;] S\!TTvJlEoanjl\R*٫Y5qWf*]Wvj\U٫Y5qWf*jf*]Wvj\U٫5qVWk5qWf*]늻*Wo5qVWvj\UZ\U٫5qWf*]Wv]qWeWw5qVy늷yWvjˮ**j\UZ\Uu]\U٫5qW]늻*Wvj\U%vY4~֗1O!/¹^hqď&xAJu-5:JUg#o?ADPd+YfJu"@~̺UK]"zHl5 &D 0S @NȍLOw}yS'*i*]PN,~- 5n4y4͈\4>Dܝz'F5x7m[kB"n I) \G?.KFR Rw5vs3'SJwwDRfrAuTߦٜ7]򫊻5qWf*j⮦jf*5qW{f*lw'Orco^i;Ls`$sOU%+O;1J?Zvco6siu CQ*|9Od59瀞bÕ|8A2JiBE'`7:*z{g:j*Z\Uu?6{W:GPw5qVWk5qWf*[\U]Wvj\U٫5qWf*]Wvj\U٫5qWf*YWk.W)v]qWe\*]qUrv%yj_cOH9ճD Ah"q䘻+vlUٱWf]v(]Dv?v^vX=WcWf] v`qWa]"K x 2Jhԫ°BaGLp@ȱolUٰ*if]]]#6FqWb{`*] C@p%*d$qS|l~aż"!>Ɵp,&aUϪI;"ȝJ)'k&4mp`K]]g|*f)v*KCWecDv8b;+Wc%]6*#6&evrJȧaJ*A8HloO~3 Q1#&1Web͊6*U\bǍWb˾)v*2@t"E$;]W|*~R5Lu`Rk[@bJ)EG&] 6)xp+.bWc+eT;,RP.]KUj`!]+ulRX yVAKTk9^Äˉw\mOc r+}gꂤRE0Md/ɵ+vlUٱWf]! 7c].ؠAW`BCp0%غo®q.HP@iW%ɕ@dy%).y6mUٰ%{b]]g|)v3v*)v?1v^%]]LUHծcf+Z0>Ǔ~/1.|ObAe4#ڝDC0L"7n,+QY`OS;> ZZ" ؔ$ 2ORުFg(ɸe"'׺|\Ҫ">8T~u/7Ci< n8tg(C^qp =5g"-98`NrOO+|h(49Ap$,W{?8/5 ZFoߎzl!{i%Ķ7;F*hsj "-Iq:؊f8-s")[jQr8Hl6|1a@FIbebf]v=Z+L *x5]v( peK "U"=1>#x [#'j0ҸYU]YYWvj\U٫5qWf*Z\U]Wvj\U٫5qWf*j*]YWvj\U٫5qVWo5qVWo5qWf*]Wvj\U٫5qVWo5qWf*j*Z\U]Wvj\U٫5qWf*Z\U]Wvj\U٫5qVWo5qWf*]Wvjf*}Rbΐ2xK~} 3}?C]wwzXxW!]OjY z;[2阚h1ͫu $/I׮#u4 .C4"9&=jE:u™ZF^%w|1Zi-D& /xkԛO=A*7PT#ro^ЮMzիyb0KF~myBO!Vmr+z^_f'qg9MY5qWf*]Wvj\Ukhzli-̿4`!q1=YDѴfxɅ3YZGOhFEisnw:0 >N:ܿ~}Ӽ)mA?O݃CZsYOO_!GT=UЕa 4Q̓*gx/Wo5qWf*]Wvj\U[\U٫5qWf*]Wvjf*j\U٫5qWf*]Wvj\Uu]\RˮvX8Uu-WթavbNbF WFH4 vlUٱWf]v*_Dv;v^v8UUٺbрA0,9W)i=VMQܩLTmL-O S v<ٰx CbeLUئ6*R)v7)vX8غ~x]\CA!*+m|Cؕ#'AII.G'4_0M26X/ ]]ecvb0RYZ< vv;eT;,bc*p8ثy+!. ]]u 08J SNI\MK]l;mơi^1Av䘻F*U`bbv=r$%ذEQ\4(ȥ*jz`K!02i=ϨI&mIl d~I}S^ݲ@SQ60ab~*)vl v<] 1KDw—eMK`kvXP~ bRp4ǚKE=WbWbKenWbi]bʖ%J7|0ґnH{9JNeM\wn.MObȋZ 6~i$ Q $ٱWf]*v*Z6 vؠQQ.D;E#S`K*w>;"wR[_T׷lMX/ ]]R~vb0RYZ< vv;eT;,bc*rbϹ~wv4ed'EjP%ݳr/O?70M ^=IUIP:|2J#O4FWpӚn6#.ʴ*:e!ŸcFB- M64Ěr̸I6;20OJ`=nx$e#,ڈG=gwvKOU|~_:zZFzz3/uc4xGGQڰs};'^_j D}?>vW6Ρ?Wvj\U٫5qWf*]7_|Ǔǖ#HM[їO=Ёw:~j__@kOlz?Ok:1iv:/'+S:.&u{/LvMMtV94@|aў%o\5qWf*_}\~jyub/Ia < r孿,|#P[Sļ@xV],M\ty<9pw6_W,.[f2t ?<m8^GG i;3n[ƹ7h Ծ/#] M v\1Yva2m4ëTN?^ȇ cn䁶)rHv66(v=G|R9%ظUتb`TH\ӷ|JCym# -iu=r_%-#WWd~9(j%vSMئ;lU* v^)v;Nv?v4Ri]u®c퀫bv(ب8YZز<ظ8TR wl.קFT-]iqJM-}mOF6r%dC}&#N&ڤa~I*p.Ǩ.1zHK@U. ;W`p7F02&wscdIdK@w9d~9( dbW"*R];,bWcH—fRX] +bc`Wg?:,7n ASOv`>f;[윻{s2_h6>x%v树{9UH$s\dN}*_Xڠ(OOD\ɍO_Qɀu{ /U=Mpkoӟj-'QÏJw!` 4iB<6ǪYwz5X|N|Oiih+iW?i.>q ^{L,͚?Z0|kf:nu|A(}:bM\9HN6pr#wlmz6E7I]8Xb͊S\%v; ,b#R P8Sem1H`1mQjeWvjf*.\U٫5qWf(vjf*\R *j\U٫]٫[\Pjf*j↳W5qVWk5qCW5qWf(vjf*]Wvj\(vjKW;5qKWvjf)vj(k5qKW;5qWf*.\U٫W5qCW5qVW5U٫.\U٫5qCW5qWf(vj\U٫]Wvjf)vj\U٫٫5qWg]s:|7goט|xs482=?Hi7R~k}ZK}*9 j^L<D6v9c!w_!I+|sI g`»C= o?5iK^E4"+L:,0i-$)î w5"ٚl b<,֗*SL?PSv&=#24xc7|ha1ߜy+;MA\wFFt/0:25qWf*\R]٫5qK֟󆿘#~LrZ}MX}vH[*xϓaoeL(H>},_^T?yP}%J}jg#Τ`yKsx}ρm_|YMm_TO~|zK~f*j\U }KcGT*${ҎOnf8/GY?ZV Q+T-sF =H_i휟d:ܶX_,-‹o\*Cv?>󒚦yy}kw$7$ (] /i&~N:pZ6 ;:ׯ;5qKW;5qWgo9KEzw-ÒW88rqAx^r/95-7Jj˧IZ0yG<̟g3ppô`Kg><5ƃϚ5αӾ\U٫5qWf*]WnW;5qWf)vj\U٫5qWf(vjf*]٫5qVWW;5qKW;5qKˮ*ˮ*cX8UY %UoR1X_g^ r3,~ko]vlUٱWf] ® 1WbFe4NRi?X`hlmi B(xK@\Si]*n;dHWc+*~;6)v^6*PeWeee].ǫSv. wL v(;۝N gYyu鎵ιPK ާ,`~;dHWbp=Wc%xY;*v*iji]u®́.k x5Ȕj~vlU ~Tċv/'w?1ڿrFUDw2'C92!"sBйڈ:b˦;c].ƣ]}E.ŀ®)cuaEN@8킧B}iF9;XlU=$+x5]]*v,*v*n)v9ZbbvX8CUy%]WbbJ*YMr)v. y~>B];= :ol#JX郒5ȕ͹~?z-$Sx®bcĥؠE`W#.ŀ®Q]0CJ*p20\OFrZ7nG!EvLU4HWbp=Wc%clRv,*v*i.SLR[,v; 6l]k?ͭ:iZ>Mh8Iy#)ςa?>WS9gŔTg6.W+Gkڞ٧ /E(p&{1w1h$Bz1 A| )L":1jVR[O5jD$( {HN2;i%ufN?V)iᘚ<*Kes7R"wC~|SN/C5 r qV젶oIִ3d4.8b6#:g^V"1U^i퓄 _Ԯn9uZ#.`@k C2!kIbhFXE;8UPثbŁ"®ǥXqWa$FOSdD|C46JDsZ;5qWf*]Wvjf*j\U٫5qWf*Z\U]Y[\ ]Wvjf*jWfk5qVWvj\U٫yuZʮ*jˮ*f*jWfvjVWW 5p+늻*Wk5qVW 5p+Wvj\U[\U٫5qVW 5p+Wo5qVWvj*Z\U®\ ]WvjWf*jVW ٫Y[/i4wP6 x\ZbhHtaCo7 \Z^[x;rk1=.j>/sr;2]XIkydPW&ao%jr}fCbtjkøfT(ݎ1締RHm:z_ m|؀ݑ5/Yd?koIwZ cte#qB+}ORgiyoq4 wτ?AouAVJ5~f]q!i=YVNr 5w4ទk?/T:Ta!+58W$<[\U٫5qWg?8ثaC@k!]]*v;6)v^6*PKWeeWcH.́.]`Wc]\c ҙ8*orPvv=Ol ~; qWeWedicdp8ثjlzbbv8y!xUٰ%p]u] vv;"c®`Wf]ڕ/O?]]H;b>9&)IDI 6W*EjvjaWcbb1Wb v Q\ v[pӰ̑ngo\"Gb8 ]unc‡e"E+ءk.́.Av^)v<We𫱘ت7c p8;/.ǃ]ب8ؠ9v*)v.|VRT TR"6Err)&V3k9"Xv[: 0Ld\I?Q5ev*)v(v,o]WE.kh8 p3$[O893䷮#YF#InN^C]K{aCU=$+x5]]Cزv8 vv7MLRW"$;/ 6C єBCЊq/%iZčWH%Y_1r`o[x~Qy_&RZEr*ܑDiwHX6ա) `>Mð|u\*5!O5ݳe~X>+ڜFĴVz|Qe%۹ pTgA:4zru㌂! +Yu~@(iLRJn"K~K2@{?Oq<-E91b w]KkvjV}nccF`:^''?Q12r +oM5;H?DY ],jv0ebf]v9M>XWbeo ])$@?lŰ Rc_ &Y-5qWf*]W .U]UˮvUpWvjˮvUqW ®\UvUpWvjWfw\\Uu]\UٱWf*]\UU]W .U®\ ]U٫]W 5p+늻*늻5qWf*\*WeW 5qWfvj隸f*]W 5p+WvjWfvjˮ*\U٫.j\*]٫]\ \U٫]C?A3i)C?^hRc;A<<'?4t࠭F}CվȴO)`AzW #T_O\.$q06Hm{o.1b݅.-R~\(؊e%b=xV#0WJU{<W+N֧Y*BԎO/G5mPԬ8N5@"6Ozծ$u6;X^\OO|{_/jNb^aP:c Dqyx'f9t%Q9h1#]9Re|y9aag6/3^1Jq'Vg%_Q~hI!aktk\;t=3/pzx?৞@j셡Yd29!YclRtERO󍲝&jk!ew-|>j.,eOLoL sj\WٹxqWdr٭$C֠/BPκ^eه0PS7%%968Xb͊ lldGgo׶,ٻa{d\ UqWeWv]qWf*®ʮ*\ ]\*\Uu[\*Up+늻*W 5qWew*٫]u®ʮ*jS.U®\ ]\U٫]W*U٫]\*U]\ Wf*\*u\3WvUqWe5pWvUqWf*]p+YU®\ ]pW5qWS*U٫5qWf*]Wvj\Uuʮ*V򫊵\ We5p\2늻*Uu]ʮo5p+Yu®[&iچjv$}Y`NEZ{2v y'oXi#B3.q"֔|*DAr.M.߈kЮ]ARi$vE'΍h:kfAyj1F\|?3**+J i EɪIrelầzB8*qd'$s,V9= Mp$!j́3oAM̏«F't3~|y̿"^Su[9fhS$N o/>Akۖ]??zƓs6F\„2򉉢l! ĐLj 8 Dvjˮ*]5qV늵"Ⱥ4Zt̠J~b*͈eً'!$>_:M痯'G#\7hc_eq|(&J^RzC|\U٫5qVWj5p+9 r,bcI*?v.͊ qWeCi S ͊ pC`).)*~6*Y;/ , ]Z8Kؠ]v6HU1#e.ۉ4Ƀ#/%b6mWvd E ƸXتRkoRO=ED3&Y) r(2؊i&$cWcsWcRi.:C$+\,bcWeHvl v<eLU 0@|RX] +bc*xȥآUب8Y[Dv* 1W`jK@qWc&n0|iHd}${)88#]DWB'Q4}X͠iݷ/'^-r XQ](]mSS\ݒ L5{ &2lD.ASQ6bxvX7Wb v^ piv8bcWeK`KwLRpF])v;(v^%C43Ϻm5!sm%M$9 dz2e{T:g݋W3O <+\ʃdm-a=ՕN0wvbDg#ˣ+1Fָ I2TQҪ ծec&8覑\qR_SƉƄ3>jY+Xq(^O_'#,l?g 6?fUx9#YTq]4/nf@6^7(.'8hx[zgO -R8PPثMT)ݒKX9L>e-cMpNp+YU­*j(k5qKW;5qKUqV\ jKW;5qV[\UVW 5qWeW5\Rjf*UqKʮ)v]qVW5qVY5p٫*u [\U[\U]\R k5qKy5qVW;5qVW5p٫Wk5qKWvjW5qCyZ\P.ʮ*]qCYU.ˮ* )vj↳W[\(k*v\Uu\U٫5qKW;*ʮ(o.Wvj▆jf*M8dݻ:O˧B lw9hD9>i.̶r[F6>waZgԻ7" P G ݖ,R76Vk.F#sȹ'pIWsNƻ~'%yUfA4+st F~-H6t+rBA2r])틕wNx9 rc==ov > SZȥB=1@Avzר/ Y6>bϟ-t,Cl$er㟙0g>y>}E瑡iρbG*wzDyn OA 6 [RoN9^• 6ߦf"O|UzW *u]Y7qϫjIW`E(j0=+Z.k4>Iȇ禁H"sGƜl&dĆ|'Ꮂo˜ ȍ>pW6>5p%u­(vj 3W ,Zʮ(o5qWek5qWS5qV]\ jC,-eW;.]늻5qCW=W *Yu[\UUZˮ)o*r늺u˭1Ko*F끐vj=n~8ȅ<5'ɂ®͊6*oj~뀚Piv"S?vF9J~Bg."joqCMWf]S]K1Wc=04]aCbٱWc.`Wf.be* v8bZ 0+K eLUا\*i W"*R];,bWcH—fRX] +bc`Wc]`*p] x4]]L sl(cnRa G6EpXIF}9n$ Y3(v/f:w8ݒbd :hc|K@wȆ}7ڝω)Z.S\&aWeLUU` ]dY;,aCU4"Bc튻]..bqWcWcH.SLR[vX8vv^l]bv(ب9Ku5Uآyذ8زU +?^8ʐE LGѓe'9sZ#N,Gm#>0E.@‡`!37ӹRE A@UFE>i?a~ZDuKX^#·jabv,®%]K*S$v+WeLP~v^)vl v?,*~v4)v`i.Ł0;Y]aq *6<+s*H>S?@_~lO:yOL,Ly` 7i 11?"|S;09ͬh+JL #W[잇$6;#3p_[[]u9`4M0QG1dw_U\(k5p+yU®ˮ*f*]Wvj⮦j\Uf*j\U٫5qWf*]Wvj\Uثy5qWf*]y5qWf*]Wvj\ ᚸU[\U٫g5qVWvj\U٫5qWf*]Wvj\U٫5qW{f*j⭜]Wvj\U<]Wvjf*j\U٫5qWf*Z\U]Ww5qWf*]Wvzq?>c)G!{VsH~?c㏹J]))5UҥҐ*xҧ>ulTBsciϙ4wӵ$"[ۧ|#M旊l#-,HZZs-cN˜a E("% fmn5]=+*+MEY'v@=vO/-B;}s9=NO:<Wg3bx`oO,毕/5F+D5?h$~XѣS=ʙVSeo63.:nނGdn-{`" 6 1m.gb`&wt/UNXUAS??󔿙7fӴm-jΓ tܜSg)8W7D ܻ!Ap\ᾆӮj\U5qV\U٫%D琵6LDSeSFF umÓÐM0:-m>s.LZ>Ggym6dBrQ<>ySp>yY<R:Ks{NVq%1-G%>?,),j>Mn|M nz4&&,<\GezuL]FG" I9=/d ʳʫԐ€| (@ꊏgpXdcWz^% R|H^ z~L1 =WWSa'PdY^\HһHqQj +V#|QyiC0s52+tvX3Wvj\U٫*YÍbSs2Bƃ[@m {uS;ǣȿ6tUT4P&?P׽35$τ-i%}#[8kwN+&όUΥߤY5qVWvM|-t(&d=9uʆK =!IwsoǥwErU٫5qWf*]j\U٫5qVWo5qWf*]Wvjf*j\U٫5qWf*f*p+–V\1]lc[[Ar7X](OLKFfi90mxv)fVN*i>hrqu;屈C EJBkSrAVǮ$+C]]v( qK%`v?vl(v( i͊].͊xxxDaWe`K]d~_`iY;,aCU4HWbp=Wc%clRv,*v*i.SLR[,v; 6l]ǃ\U~%]آU ثPAGN2闾g=\QMafC` ҧZdS q^G`]W Roޫ}m>8r+75,o/ lUAWc턄c)v9Ol(v; Dv?2vX4Cزv8UURr6=1K\<* v8]ب8آب8KelVUغ] UQ}f!B];=):Tw,u;kl%l)=Sf`oMhpIZ7sT?Gdqkdk/kvn`kaWeWcdiWcc!]`C]®eKزv8ثثS-ZضvX8vv}PЯ<;-߄WFnUqkqf#X< (XH 0O<%wk(qXR6/F@@)=w.POWs;]j (E!O2i*k<1z)2;=zvBlg ʻ|~RQ SjǖWA!޳WR.^'qZS%ZJ)d]sU,4z'v!{mqHV٘ SRAD٪N}ޭy;M&yAdTbLN/.j+SCOdlzm#}ʭ-C}ԇֿ(twLo& aDޙ~ғQRsu t'Stt վq{KqTn^5姛5"녚LvzX‡ϥ;+#!͌㑉Kh!# F@k^j隸Wvj\U٫5qWf*K8 XޟR)D?Q>9{C㏋Anphjcvits:VLyBK sMeYb՟$-<5!Ii}grKm*2 |'Z\zWԮ$ahXi郷y$ec[?|åFv-"xc:$Qz ~k<*M_Lms)ZmǓ>Ab4vp$ic@{EZ٫]y5qWgVӼzxʞh xf#xaٳ>5-#t9/?/u X;nj)(8?=my+#H)EU}h mDSX8'\(o5qWf*]]v[5^f6kJFzlj2"$c{w)P74*]yWvj\U٫5qWf*]Wvj\U٫5qWf*]Wvj\UK]p<RWbRt1J*.kȕ푈$O4HR h[ӧœb:,D1u9R%3Ko z{iMYi&`J8X\UبjWcWf®\UUف*PKK]] \ p=WcٱK%نث@k.]]]8&!+[? wȫ/ lU Ąc)v9Ol(v; Dv?2vX8v;N]®c]UqeWeK p)v< 0+A2*za*}0%٩u[CarK\]* i|'\ӶmWEZGiVJZF7Ar1LdivCjN.]v9M>XWbxUkv<$;.ǃ]\bc*v6lR K,.bQR~v8BWe p+E4.<ت1KU4ȫBJ] .jmM'jv9t%mro8J7XmaƆ%WM%o\+/EWGDq4!v5'rs!UٱWeMWb"®v;*x=!!];])"Bǃ\UxUx;,T;'caWcqKbv8y!:(y [l;TQOnӲ3pd93q!jZz)OE~$Ϸu3@ I\k1naN$H=rxICk]>#h$2]Q>g4Yuvvǹ"/=uH.!x<> C!E#1z2/\Ҧ6𪹣Jō.`y&<6=3_O" c,|c~V{UabHYo!|-em)sJ当zmD.$?O?|x$}9#'O>!7L dRx8U ث=YPߴ?[]}^SmiMGLT9r#W"RāOSSc\RUi8WeWvj\U٫5qW|[\U[\UWvjf*]Y5qVyyᚸt͊yWo5qWf*j\U٫5qWf*3Wvjf*]yyy5qWf*jf]y\UUZ\U5qVWw\[\U٫Wvj\UZ\U3Wvj5qWf*[\U]L]L]Wwj\UZ\U٫ {-ooWrHV N 3@%JX44fRϷuך`5OMx #u_ɋcafQq|E,kt`zw ?5V=iNc'Okۙ+A AWDRмr6ݘC26V@䤾[?$It֛x&]hzo_Qz:M$8e(twNNdE*ooNIK‡w#3X js5N&L.BF;s~~_yOϜ;G:W~1K(V==X~Zڳyde>YWo5qVWvj*]}B_k{IXeC9^\Q (HCZCW$U*bl8B)쵴fRslqvyn7\w}P#C TGţ\[J.Q2/T'^o%$&gdB|ZUit]~goՍV10Xeqy>ѶzF> ~G;8[ӭvfFc>ӈ\z;f2|^ ?LWZXZ=W y:_Q>CP]o;IZ3u)Rzg~|s; GH5x]cqC*XWeWf]WeLUئN͊*v*iCL/v<‡fĥxif]]]/J,+®ǃ\UxAWcBCx5‡eAD*)vl v8ؤecvb+.b*~v8bJ/] K RPoǮv*0%%]vQȆn, ?Ө̘JT;$v7&!+ 7Cil Vy=$iH'&)> dvs,OSA6FvV(vlUٱWcUئv^v<ؠ5B].ǃ\(v8bE]UxRp8ec+.bWc+Jc(v()v*G])팂Ą ]fSF)U xa](]Ylk t$l)[C$|<=""I (vlUٱWf]SOخv^v<  pv pxPk*)vl v8ؤecvb+.bWc+Hԥﭵ[SImIT523 {dKIRTdaE3%i<3]oyY#o1s ynj'y֏|i$ C2\F}\PUqKYu]-f*V*]qC~٫Zʮ*rUˮ*.ʮ*Pek*W7\U٫f*]\Ue٫\3W;5qKYu]*Wv8 v8bb R<U.ǩ*4.'#icV>ބGkL s v3 vlU4`!]WeWfWc8 vlUk/ SL+L6*x5®Rإx"Z3zl+L 쾘U*채n v<Cv( r*p4—fc)])v7S\ L p;/Hvһ\-fG'A43%?V>2j= ѦxgnW9TՓȮavcmR7;qWeb͊6*UZaWeLUUr\,b:WeLHWbvX4WexA`v?F04bb| pPv!]]*P]v(ؠ>Y[Dv*LU  v/ONN+8ҵ߹4Ðqd/\jլ:?r(\ٱWf]vlUn S/v?*채n v<Cv( r*p4—fc))v;1Rn)v,][? |غߔ.&faQO MY L0C1؃K!s;U1}n\3qĮo9srf"[`?3Ofӱǹjm]z,+i/Kqp4+P??J24 7/ͺ]`cLK2.vUqCWvj\U٫5qVj*㚸Wvj3Wvj\U٫5qW{*]Wwj\U٫5qW{f*]Wvj\U٫5qWf*㚸Wvj\U٫5qVWk5qWf*]Wvj\U٫5qWf*]j\U٫5qW{f*]Ww5qWf*]Wvj⮦j\U\U٫5qWf*]Wvj5qWf*]Wvj\U٫5qWf*~Ǒ|y yH-lY G*iB)hk8KqkQËsezsvNGʼf'џI‘_ klG玆P0J4'+Ku] (hc*C|a.懄Zk0IbbU*Tw&7C& .;++!戴2 RLD=@M+)]y̚C["VT3A!N@Ԩ9Ogkc 8.!uٱr14[i$ȡ+JcZj*]Wvj⮦j\U߯5qWg?%dܿ䒑jZ՜xf{4x\6.O ׶P Bփمv?Aϥw0GH(qxS ApLW@z(Hn MS*4s09$!}㞎еhY ǩZ=FoLNKOʏf=F*e<9|>ÿ%4m,%5vZ(Pv޵ :Hw #ۑǙ@K%s /?P0<}w:X`(5|GLy Xo~܎ j;- +gqo?f ߧ@疭o`MBֿ@4< [ss"O4ME &9cp>C<8y1FmV2(T w5>fu}2I+Z~Z(/ȱH}9{#Lt'Lk݌{3VGX?e|!4seXqn>=sx5qWf*]\UU]늻5qWeWvjϡsO+{H!3Z5di_A۶s# vݝ.;=̞LS8TM{;8 :ɤ&q۫XHG89a ~a_.^y ʬ(#w*?Tr'hd㝿hV.R0ZQ}<\. Z\U٫5qWf*]YgǗtUg7%TY8,zg#D~o?$ qʭ H }'k˩iadխ PG~s72;)>]Y=-@U2:Dnf*]Wvj\Uu]\U٫5qWf*]Wvjˮ*UqVWvj\U٫Y.5qWevV*\U`c(vX8xc.njU񊷏0+=} $i+18-~1擦|qkEFn(bMbc)v7;6*ثbUDv;v^v8ثثb)v^,bͅDv;,U(vlR vlUؠ5.ţ;9(kgثt]\%v; ,UB 0'eL(v?  S*vv^,m]œ]]8jbb~[5 9v3oo:RTǾSGmVb M?91|Š2e@Ċ0LGʟn)մO'_UTT?>`Ҥ;%Lˈ ݥf"،)$CF[0@Yܜ gF4M>&@R|Rbvjf*[\U[͊5qVWvlUevj\UثWk5qWf*jf*j\U]yyWvj\UٱVWvj\U٫yyo5qWf*j*j*j*j*j*ثYU]\UU]L]\U٫Y5qWf*jf*[\U[\U٫5qVWo5qWf*j\Uʙ-Dx dv$(Oo͟;ip^Tn4˚f(#uT@ _ &C&XbVGb)dݍfݝ?2Aoa -:rHDWLk? LX9켒CޕXIO]gp?ڬ7[9B]ldVC# a9$_;%qnW;>sYoX$vV?MʃA HBt_rGdK_j5ğȯ).miIfX2(fSojjeD~&Qھitާ9f+EмHփ/JTRsG&PIɒf܏ɾ0y3JOZmϜ&~f$;<a]kw0}f969n=4bjD",J0^j:j1`-ϗ-m I6&V;d>|ԭҸU65;g kyї1szyg͚N'$ H )><@YTd*7lGqo J7=)9;W\UU]5qVWk5qWf*j\U٫%{1_ G3S|Cx䎨OGM3Ukfnj"u5+ʼϟtozq@y0JA;ϒ?/.>om}hcB A#m>A1q6>=I9*C~*Z\U٫5qVWv}, ^ϱ'k㋯$vvB`cέ(jV^oȌTU5?x9V<^ VCxXАU^"A_ir=̞aVq!H߅( >jOl]y5qVWvj\U]Wvjf*ثWvj\U٫Wvj\Uvj\U[\U٫y,bc[k0xc)v<㗮*P v6ID*](&SS;rnk_v yBқN˩Eqa["vJڋPa]6*ثt]\/v^v8b 1Wb]]*~* \ U{baCbeKLUؠ]?1VثbŁE]]*vU{bBCl(v; S]+ءk/ /'ecdx5]LY;CM%]Wb%v( Wb](RX `KP+ xB>F=XȻ‚}y>#&bHw,NFRk@8*)v?6*/O,1!ؽǨ=7C6Z# /OlK!mACa]vlU4`!]WeWc* !! v<CWb"vWebv^6lR K1—cqKTjpv?1v^%])إب]fc~cMr6moz,&+0%uqWe]v:n1^zJLD7a2c1Wf]vlU`v, r**p8AWc dRrPvv(dWcCv^v^Nbp+WcqKKOםoc#LvrNȌ&wڏN;oSIfMb%vVc̰4bI"0CZ|]+nWrjf&Hq)C%Y2 "J@Scҹ@O--VkEj$T##ڱZJٮޝsWy%lgWqƵ#gʟ)-kPE~FFm4D𞎣W_{L^lʓZqg31z_Ozw98ƘH۱kX=lɨ▲\U٫*٫]Y\UٱKW;5qKW;5qKWvjˮ*͊5qWf*]W;5qKWvj\U٫5qWf*ثWvj\U٫5qWf(vj\R]W;5qKb\U٫5qWf*]٫]vjf)vjf)vj\P]٫5qWf(vjf]Wvjf)vj\U٫T ,F悸Jt*~R,c򎃨OPmT_li܆aQ{nFw(~sydsYGU~oȟ jil=. 7Cϧ-̚|` z3ʟ?>I3]tBߨRHsZ+q_}Pyd)ζAobA^o:8/~௖GEH|;I|u5Y'S;>M/ptV!;G"?&i_cy=V{VN^?6vxfS۝I!cZZH쫓OmT/ě\g $4Џr\"AHIX~[u6Leux.^2rT(* 7K;Ǩf} j$EK{ ?km& BWHa,RMsL v[$w#;o5۸I=2e՗#akPٝ@DEx ubpOKJ |'(icoךc-~ LmxIo~xocv qرc~!B $cS{Š'Za4I"Xf.~>BrBN|E4ieD[X^h&y8Ef*gmt [s?hc91[O/]jͯ!э+XZM{G7ђب4U&P{3ǟ[/d0A MI\!b@ {ȏ_7Y\jIg4m:1zb4jS{Cd:}0#s/=/KJ[7<|aZ2~i\ƨſqUvl=u|m/dE3]6s![)%e ~f*ثWvj\U٫٫5qWf*]b\U٫W5qWf(vlR]b\U٫5qWf*]Wc*U]1KlUX(zba<қdIk&ׁLq f7.ư(qAN @Ӹ& 6b~i~™tl-nĎv7;+vlUٱWeMWb|/ 7LU*U`v)b,a"S ]x6u'?kg2Wf]v9M>XWbxUk/*x5BCx5‡eAG/;ٰ%{b].Ǎ%aWf.jpF\v*b`d\ O"M; b5eg,`Dec;}-..5#TwV\]Weu¹00t-auqaotmt [!Cᄘ-tnƜRPثbǣv8 ]FP!.c; 1Wb"LP~*)vl v8]]و—cqKe5`WcĨv;\]pgsdȻ~>[\PuqKWc.ǃ*\iZԌ~ᑌȿLٱWf]vlUj`!]WeWc*  v;]PUب5Weٰ%{b]]و]3]JB!ԍ|d$ټ3X|s9_\H\Z"3PL |/̺Yf"Fzsam$E&Fكy㶗xg#G}_4rU#kezMAcJ:?l? Zfe:bfxT}{QGy^Ri2KaYrxg>פjv:MwyqbjS9W;;<2tb~Aɇee: Tofʧ;?Ժ8ġ}9cߟbjW9_Gɇc,˷mُ~f|>'Ϛ}ƭQQH.OL࣬+(̓/ȀI@ #>$˿󇿑~MﭼFfN4EuR@h>vp# raKwMοG^QA|D & `IQS$ $33X?9b =alĊ@{4Hܬ[8> T>mGB=EQmx[Go'йLcd#r'V~׮q)y^[a]'O)5{Q:D7#P}8dKdg^]2C<襇s$Y[leE 4't,q=ğ %ߒG}W7:&(^/1ǙAU/S~_5Kon*KvڜxTDOccW HDv!6 +eAAz8I$P]Gf|3zd`?˛H۔+MI5랙+PD kyC:M0A_Ŗs.2 5^eFFռvvlU4i CrG̍> V#_=s41fߗ=ϼ-V|v[^eJ(%PgC,7kCEu`m;JMnw Z~)D]@{XcqzyS4bz̝9q@xrsxR]-B~nYjS-.ѬcW֗;w`S:!z/ge'7>?mAɸ##̖-%XkT[Y&?>{Sߔw0G9 WG[IfV ؖj<8uɒvYtx^7F]4iXL OsYyo.yNKkO tl'cf (YksOQ*H9`*OyfҸH\U٫5qWf]Wvj\U٫5qKџ=YhmJڲ5`)#!waٹ']<Ѳk/]O2lRv_~KPs%iw"]- Ozx+T`yuGv!Tz ;=\UWvj͊5qWf*"Vpip^/v}~h&jiE\ge㏜Q537jT#뫿})dOm^@\(G4ޙzοLWvj\U٫5qWf*]Wvj\U٫5qWf]Wvj\U٫5qWf*]Wvj͊5qWf*إኻ/vXWbxUف*~*U=Kثv^;`!]dUٺb];;/?1p?F)~cqCb͊6*zcv)] vX7Wb v^Piv8bcWeK%) Y;wYeN)7ȫe ](;QHvgB1M; iܳ9eS_6Tr'EռTdU{`!.LB]ni]N*^# ͡r/Y}]X98Jo ɱv7;+vlUٱWb"U*i 2\] 1Wb%vX4E\,bcK`Kqd 1Wc+aKM)v, wအUcWoza$ӰVs,ha8[Y,Up%ؠ8ǃ]v_] \l ,[ tkWaZٱWf]vlUآcv?,m]늻/%]\ v^PiWb"LP~*)vl v<] 1KDw—d͒y#zWab2=Q}d,92^lg~\ͺ 弐|Yv?A?B][h[fgEu# +`kb@(JqsOt&iX$NF>*T4Z-Hɚux~&\PKOiZz8U,-- KQ8/{fZie#}(rI_δid[[eL!U.MS#eG#ʨD^橭Xm&Kmt֛3@1GrTbӥc%^uR (a>8&+ϝs¼_8)3_n{?֐{O_=[SWN_ɣdɓPMUHy~AGͫigc[zvf;˵9S4ucmpunJ_Gpە>,?yWLMéo}Q#Z08h.}8!.:UX~q~(*@Vk0[wjWZlJFʤnJNz}=3GLo&sK;vs؄Lv\=E"b5>79aa%}d{+~ eTaS#is6"}ZC22зe#-^CEFGrszJ qX&phZ1ؚ*fp\Gm򩄪4AU+Һ+xtZFh@IwnS]0-T]WȺidfso{IiFv]h,~#>~ `G4~1OD"+rO2>/˝?Ri5-nQ`Bx g5xa8c}ow߳rd-ؕtW.e}nIZW9U/m-&~0׳Ϗ=fO飷bt=(C(\_z/%??vOMyS^X,n_eM*v͗^ie/9'@ omL'%_K3B#̨JiZ9g7/'K[NY}h=M^C,aaA΅lM18}~~a~TY~jSykYmĖ5.O~1?x$r~{@?XFc"]Yh0F~vu.m}&h5gpӈz0[\Zb\U٫5qWevUqWevUqWf*]늻*늻5qWeWvjˮ*]WvUqWf*]\U٫+v8bc*v*p]ؠ*p.njU큌;HSȔD.# xUxٱWf]ʜ!(!6T_d9 7vG-BScba.f]vlUآcv?/ ,UUٱWclRv0v?*(v=Ocv?"v) /v;K~cZl)}]Hodc+e!O,#$cqCb͊6*UZ]b1WeL5v? eL*S  02*p4aWcp.,]Ka]dQv. v,Wb 9j-N8dzIJ7J@oipc< ث/H"݅Jmܣ2lȋ*aU#+"g7\ڵ;|F\ M3f]vn`kaWeWcdiWcc!]`C]®eKزv8ثثS-ZضvX8la拧aUJ&6c A%.k*8R*o*x8x8cR%x=+gfݷOol2 o L]vlUٱWf]W;+U`v?vX4sWb,aWc S"®f.œ*~*i>+ya]2G~Si?' ]yMr|Cs[1ŠGs544L D3YutC|5\.x~fXm!vy S $L**9 %ų2trnJi_@}26Okkpf)_5 *x>K07FAx~Fڧӛ.g1Æ^;q(|-VDZ o~'3Fs'\P*j\U٫5qVWvlU]y5qVWvj\UZ͊YVWk6*[͊yWvlU]Wk6*]b*]YYbf*jf*jf*[\U٫5qVWv I U&&`s)<>_r5VWVyi-d=0 Q&Ly~M Ru{(i'o碠os4$U:(=9/RPE\U٫5qWf*]k5qVWk5qVWvj\U5qWf*Z\U٫o5qVWvj*jZ\UثK;/x]x[)v8bb7WozbipZcɲ,0 c늻/"eWef]v8k6AC61!9*JBL`R01KCb͊6*UZUxU{bb͊xi6;x4] *v*q'?!G?u,K*UNRvo! r!ul֮cnAh6E7Nv7;6*ثt]\%v; ,UB 0j~E;]S"Bǩإ] ]1Hv*|Y;\RT }1dY6b@dRrq1v!iqOܿN-"4|F/ul(Q>" 2"Ȍ4LcP)؉ٱWf] 7]\/ lU Ąc)v8Pvv(dWcCv^v^Nbp+URr68ء Y,vaH1d\UUZ\U]XqKxǃ])v<U19bYTrJBDmmӱh6E7ٱWf]v`i*XaWev?L$(v?"` ®ǩ!]c튻].Y;lUUCp3 g{;,r3e~{/|m =m1f'a_>XȈagpˍ̈RXR í~Y lBg-RU+O1O.Cb˂s@c7̼=YHCZ<+eWn~fsB=1g_˿6|k-Hba<[1jI;߸>_|u-+\H#z<-~hjVۥEO0( {Y=_\w5qᄺ> vDp:K tߞ^Bm!LL}~Mj0µIP}ƙxݠ92Q\XMaJ^j\U٫5qW|Wvj\UٱWf*|]vj\U٫5qVWo5qWf*]Wvj\U[j\U٫5qWf*]Wvj͊5qWf*]k5qVWvlU٫o5qWf*];?'kk>_OWB4jR@AE"CGu6;8}Zg囤MO&#NjGӚ,1K ܘrHrK$MRG;>ɾ[.Y34#5l&$@?sx칞f 0}l37ZG! ~vUs(Fc=~lÑvo¯ɭ28nuQ@vY#W5.Oros׵9 *ͦ~SQXG[왡O̞Zeqr cP=\ƙ#!K_,yz f6?L/sYw'乵5]ܮ@ i\C !QGRvC/'[ĥiI;i`_5,FynjvN D_YP<=eO!kDR>;O<ɪZ]KrW/C"P\7ܯ?[ߙ7W~vG=fiPEK?d\'R5'xc7":^)9s?sμih%֝ij8dVj-*(4Vm3@eqWlm˵{F<7WWDmZ-N!Tq1 x1LjjfpC7VI}M@w'!+KJ;bT *7%\hjc m*p18x-VWQ/;Ao'f4TTcZV6:NϪ<8G9B*?^UuЎ,SJ*op{ Y0*_"[.3D+݇לoX~LXwK"7&jnp %SuhkbkLnQܖh@ʺqw0|X*~>zmwIvtSxj=YW眼?@YE:fHN4}|Sʾ}Ag&׿=<53z`XO>OhhT|^XbW9)翘Mi~̶,tZ_bkGdpTH#~.1:tZMku4w?GF~i~jiZCkZ2N>ܮAnG;eٳO?;+vNrzt.]VQ ;(Lz?52|MkS礼ג{Gl}g_v1])-Hf*]Wvj\U٫5qWf*]Wvj\U٫5qW|Wvj\U[\UٱWf*j*챊1Wc]v(1WcRH"R۩\%%r_5 l2 ݏVݰ%خv^%]CKblUؐfĈhGLc*o(ȼ5;(v4ebf]vn`kWe®ǃ\UxLUا\ v^)v9OlUUcl(v*7 U*P -OC oe ~LNnz9iH6n(îZ7jv$qWebf]vX4]\/ *vU{bBC;]S\ PxF*p®ǁUT Y;].@ثvœJ@ƐK!DхXȔ7/ pL ~*p9KWc+b˻~?NK\kYArD[( //4tK!mXlzN]vlU4`!]WeWc*  `K JPP—fcAv^)v<Wf"Rn)vb㆘R( &8YU]*]늻,Rx8Wc®dž.ǃ]W] ~ODA"nqFUٱWf]vX4ī`kWeWc] lHHv;"caWbk@v;; qWeWedqP]œWgay:Fˌ^-zp5vv(?~s2/$~S9G%3/\#rZ4>N@Kzl[4۩D;D mB}c_IASm zMJչ*/p %weo0_Q_HH,v4kdkG^rGfÉB=iz%zy(#JaZ,I pD9iBp3b̝[]]BIMӟpQ.}A䰩vso _F~H,~`6?{X2fv$|"Vvf7qCySբE5NTњ]o-r= &IK5+Si7k?1.-: i:tji4Z#v~Q"\{ק#:>ddO4LBxf70_fu!'C#}_ʭ6|ͨ\mɭqA&_!G&=s%/4߹P"zK_V}gώ{ u2tF:<1VTnF<m#?ZV]PZ 5~es.W\'ȖyD!kr}ΉiJ1k[YB$q-{ fz r73"}DrCHB}<Ũ&s5[ 8q|QT > o.;eT.pw=*kuRJ>e m,kzf1+F5O#~S>a%"r4i^ ҢW|Wgk;Z&X#q}ri͖~RGԏu-_ZXK=*k!ت<̃ӈ9V:q4y rwseq]k41;,PI"**v͖؝v H1WV=~9˄$ן ԼkFeɴX^w rȑeBjSQ=+%|p@e'az@s䯘',aSyyL1LʐʬL~UZSͨ @qI=G0_[,j?yw$QHzg=sͻ}Gjux/-=Υ?.}_Lszɻ-w=qmަ~/ş/7?6#VIqQzgk>?~B.qݡxqc.Q5򳿓]YN_Ӟ];F)R]HҀK)$XV4S[ÿ"$]򞡯Ŕ<"q$̼Evi1O,ɓ"3ur` OǑ?>| խ't>c Gކ`^ zrO񏁥淗zR/--c%7¼`*ǮtodǙvKnJrzk*ϣ ~^鿖_i/Vfڮ!XhѯmTyO)#`xo|>w-^cnEQouj:5CE=?+7%PF"Q1 Dp$Hl;FGʾOk?sD&Z**#J.co@tV#>XmmF"P}bF+Q03Osj2}9"WSFf!di"!K D $"WQmz 2 )u=Ṳ0$&&<DN<#Ϻ%p:UBH\vdt4dt`Qрdp0#>ϸ.?h^o,ɤ#4XhUP9~gOh`"MqFCZG/mkI }.#/1=Bg]9wjT;`<q#T_^MR6*k_ڽqs[rc#Jk*OghYjG`9FQ9S{#MQ4 JDGR; 뻓f1~C/[^_ ?^`6<fkg?ވ-mc- A$wVHW>ӟ3q5=%-WPf-]AxaWm' +ҭ<%]vA4=PK"/o/,yGC#nM~Y7цfKL02WPG Ny^Gh}bn{ӵ)&рqeژ[M)Gݘ ߙ?LicuOq,p7iExb;@vT_T?%@etG;h CZh䜇Q.ڑmm,us៞zf ?qm Ov:\_:QwqOi=ShC#ʼnEgmX) $(oq9A( 9d=O3M":u ye>2;798ǐG*W$r]\R]v~w O,b V6њx)Rok:GR|F|D󇖯\{]}k!I nzQ_ra`{ewq-09.?o&وQI[cI~mRO)<36{uݥ@Dfl ڏ,NrwU܏s~叙tvR\؊5]R8 xxLdLLuO(e.cG{]x[g8I7omy#WJD/ľY*UwJ!>S"{oeج36prq]jF [Nhb +PҨCdPA;_tuZ@cÿE;9nlL9F%+UĻ>ݎo}L8 Er1 Pٹ2a mxc 2>[hEz ~Үj\UU]6(vlUٱKW;5qWf)w\a>44lDc0/%X|9X>fUܖu?7V^$z +S/C/G1xq8?/#Lj&qJܢqWcI]*ʮ*p8]*x8K@pK@qWb{cV#FF&Zn͊6*ثb+Sl+\ *x5]v( peK J쾘ا\UxR;ߟ/WI򽜗S*UO7A 'K\0elڗ.ᴷPIy(oEE?Vj6#M~1| y~,d 9(yRz pb#鱑?6F4:|;?g#i_%_|I*DHb#јDD@/2^zz?V=O&ES+>4o34hd2H`791 2Jy- ə'z\cSKUBa ރ "(rn!,6nm/IemI tĵ5mndnhz$SgF >%Zޜ Es>>9K-Vn,4K9^<$*x'bNo4i#ŞB>V1~ʳi^$@I'U䆉so8^gqgP v5ipD{L8HG`rGTMOUm#ݝ /%>u,SGN4:VxֹѸoZ\U٫5qWf*ˮ*ᚸ.yUZ\U.UVvjˮ*\2Wf*\U٫5qW|aWeW.WeV`VWf]D䯦րIO+Zyε>Q5 H/ MWm\v /}p)? gb'&F4-ǝbw24ڿl;Me} PyO·wY/ϰ4K%*Op] 1Q_s)hqˆsPhQ쌄oA)VHcY$ P~9|>С' ~-^:l bU&R ?!Lj੔gɇcKOIKێ >Qw^aV-YOO_Bvf(sڕ|"T9ִ_O_(9@]Tw|{3UKR+&i~qGP2j\ u3E[H-P|1JӣS9Ȟ?9JyJܜ,ÿ(bV|es"ʜU,nV<]T`.%ֹG(EŨ\4F08f^. `Ȟ~24,d^&ר[izE99,EYʣrv {~;4EIZH;D>%yV+ͧs=nUC>֟+#]pH$y4-.mݔn/^evz(^p_095aYi*a+cZe8>Q?_ƟheT/R я~IQ=ԯ mvט5&0-k~e֮[yw,P}V" #$eS/V-Y('^mCum ~Wƕ/5ڭ3L)%׭?(KXNU&@~LhZ+-Yo|VZ)`:G^GKq_}/0h-'VR-ىVG? ,mMWЀ]{RW'>~͏gi?7=Oļ73&a[ ˧>d?1N3ZG.^/yN-sAeA lMѷywHVe5eaR?W?\<3E$! 8|&v&\2x!]+|ըkV5Z~F2Dϊ_+-2t'Xb4-̮X|=΄FRd@y?!~`umfK;-:)&Jx=|{ c$ŤI r*3=ʉےh)4zhL}o 7sHi7a+R=7ztǖ3C$HXWSC4ƀΦzs~,yrsbBԜ4]b?X1$l=K?NS}?}>7>°MsCΫݙ_ND?KfC(d2bʾ[5_5W}A&ǶϖmsʶHd'Ľ*_ &yA,oIR5CM:zXn_TnzúphOMz8k{W:xSM21D(4brZш>ڝf =DiK)~ߒfܞjnԴaK$bqHʅ߿3o)sHJ]`ssOF֌ D$ ٭h=Bsp#oxQ!&宵{Lߑ=.g6=Ls+"K(fwFu}xMp*F=pC0}#XI\YhA}kpir&e&ecDZ>z旰4$wO$>+K{}ṹ3ji"jw}V/ k >Nef4$]ҤӫFPDfw&@Wz}"Yȯ3O+ -ceyE]H^?bb;m}羁<4د/H c| |{efa?Ŕ=;rZ__7;jg!a▷K~|C-VbcsKpH[>]X|c( 7gI-Bj* +xϰ>ޞ#K72?};@KQ.t# ESGH sy;:w{9EbdTBZ 䑹!Np0jJyq.e}jZs}# |ykGe5 ;~?TA =_T+ Bn gKF!}r?h{~\7,|7_>@}"?OqmGMcc%~IO ]pjmǤXA9$gC]ܸNs.yPMbU-{sbX/8b)$.~ΗOog`1ۼ_]_SXCBQ~y[ơwY'E$f#78q"@9#̔-axE#@ȵs)#..Y5qWf*]ok+v]qWf* >OͻmBd aX9M죭o?v}%w|e2s3"O"_ d򗛵o9NQOM}@ nC"RWs?Oڹc8*=s8@?1=[mblkQ=Avѭ,q ⨀*;6226]ldlʼnf$Ԝ:={5,o,M$a2RETӸͿae0‰hg3K.@<ӯ/Ljb8JБOOmί<Ba6r)6Z5q>sQڣq4@ZZXHu(Y^ qFI#bv },rN&"Ru5T}8cٱWf*ʮ*ʮ*\*/5?2é[Mjũ?<]9=cٓ]5Jzn",l W{)y[&kyY2 P|{,'~iË=|8.:yBRW[[ր']|je+v^*]7Y,zȠQZ8sC?H'DJ'ޝ}u@vyw9kꭐ%c"W_捷߭چr3y H{ɳMe^ A,k6*]\UU]Wv]qWf*߶jS5qWf*]\2]b\U٫][\U]\UٱKv8b UlRlx]A.*x.ۻgO:Ep'S"Jl v^v0ٰ+Uj+ثvl v6*ث!Hv/er"& a}=KNF?}`iF;#vlUٱWcv+]]b]S.]*vv(WbdUآ]_qJ)hw4Bez9M[ c:m`ӰfDֆ"Ԭ6p]22.]vlUآcv?,m]늻%]!.XaClJ] !]ثp1Wb1Hv*NAإxnq#bFG: *0=N$7S\ v;(v^%] 1Kv8ثثi]" t8Anb^Oe_3 %P˸8mA emR7!PUٱWf]W"vWcLUئ*ii]aWcئE];].͊] k`t^Gabʼn+q⥼i8G\P6*]UqK[\RLx8|PUx8(*()vY# 6|kq0o lvlUٱWf]+v8Wc+v?v85v<J].;,bBv8bcWeK᧘y 4(-o,ҿX ^li$bC] Zf-t d6t2hf/'4Q]`>IonDu<]KhGŜ +Y$=%vP4bſda̗vXs 0bgV>,m=S`mE#b3 k%..Ҭ7kxjІ&lg'#)m\1'1K\՛ICk:`sI9ƜrA[-ٕ SLM"69^]H7<@:Q-33R'+iY HS 1TT<#ӓԚw2-%$51~|aiv,ޯ!! iȠ; Cg @NuBg?RP7Z j7g=mwQaoUx:qi4@\9O0˹v;0 M&B|'u[\U٫.Wo5qV\Uu[ʮ*^*j­f*]qVlUrZˮo5qW{eWk6*UXU:e2[r+ l2=p:f▅q_4z,i?gcyv@;sys}uC,~qN oj"!T?࡬G1ҹ_ʜvD2JY/#ЅSpL?&qERWsJ{7߈#-1h <ŪKP}sO)v%ݼYƝ5:^_1,g#V yg`37M?VNC- k+}ϧo4QL齇 ed R骾י}f!'61!oع4{^X8_'7fS:/_-N8#Yfď>*LЈxָ̿]+]|H$3WW=1gq$ckouA Zz!̑9 Z[~vyCXOb."imnbC#5ݿeU7`i1io45f9V8&?p7=_b}81 ~C>)dz'v;IY[g-vPnqFZ40Z?0ɼnO_7}}s;HO=[O2TN}^RRW+8)t yc@4jTAc5{h~@qڙ* _f7/n=l(eaN2'?:8#2m4_X1_L_ⴴ!E98U]dhc؁)lI&|Y*tM'P/wSok,>z~6s&NWGXahFK|wItϪ38?i7)tMbc.! 5<f)ݳ$[Ap_^>8Uo:q5#wb#@H@+Q柬Q.Ujġy;5ޣI짵8;#9͖^VohNj&.F|oPXdBHHBdTs^oLazk׺0 UYT Oj|Fٽda0s+$Țڅr=K ݒyO'sɧj:urG1 jժʣ?zw/|KHp7vӢr$p9P9#:hA˞&a#*豌O&k9XF+G5LY'ukק,Lm`;~U,f5Rv^ö|~;HV|>ǯŦ?Sj(̧;v9NN.^sLw]kj<8pgPִX>iѿ,h_OGMsZݩqtt"~yjhRɤCRڪ-b3,(<1~EfhqRrK-FCU[Xi )LJ+}כ_[oSH"mOmWq Mд;wco3dMhq g^?7XMIe?n'JQjğa,엟y'Nt >ٺGZZgـ۷+yu>g?$G~{2{I~n-,u]_vRq Cl铬<5o͍?˰ǥm$;0ϩi;/y5m6Yi<-?~nht-[-A4VHbP\y5+ZTөG'\ Svx[)Iǟ*^+^:!3AEu46ڦm5+9>RwySz4UDwM{&yfe`Yc>b往EмܵޣpךɵW8ᵹ? 'F>,C?)}YwwejA`@QFֻSk ,q "1Dߧ٭G###,Wϙ5/41k EuC 1vsMϢj(wNmFz5IqʭgyZ{5>0L<X᳷N~F.ԓ8(4-7זʈwA#2F J@l6% (XCn]HV.4j 9uˏ/ͫH]MR:)91b4S#G]˴p؜?Z$v2i@A)6vJ}痽ŗjbSXH@10<}?trʚ5bnq!`:W:{14A?=<9 ?xyW[ma,}#3+ ~{f4$T.ڙgmYg疺 &KKX4cĚƹo٘߼˵2˪kط1?19Wr+[{m[͚7!pA^T΋ ?_?΍^{$[h䰜WIn}K~fx}ѣ#򽭇-/d4_?GO<9\]c!ʮ*]qVWvj\UXW 5qVeWgOW^z5ῇc,^. Gȷ0|_15yh_6ϸ?\ߒ }qZá1$b"L?7-<ӧpmb*n \~W ثYWfv+"2 H4s8u+KɣZZߞ[ڙ!g?H~RdSch] Kם|\J(ͨܚOaMӊ>o k_ msC.ˮo畊.yU]w5qWfk6vj]Y5p[\U[\UXY5qVWk5qV늵ኻ1Wc*(6ck0%Pbbb!_a\wF.96)v^)vl*n)v`iv, w]ȡxUxٱWf]q `wKͅCd7h\(& Q,",]8Pثb͊VpWeWe6*QM~x0%*To0d9ذq9(G?wok㒌ZOӷ\%0Ċzlpےv=țjn(vlUٱWf]W;+U`v?v8dadp4]*QvdUت{Wbbb0%ؠNƱ}JF0{Gn"Fv`i)v, w aWfc`Wc*p4B]K]͊@'Z~rQ v1cg]̀4RFFH9"wV6h6E;*n(vlUٱWf銻JvvX8v8a"'eL(v? Dv)v; /]!/7VbqV eqVW \ ]qVWk*UWc\q!qWcZ­bKxqV@qKyd(w BFom~_z{{dmBY&.͊6*ثbUWc*~*i2 vX4®WcئE];]֯7U,C~}U8g.`ᔁU_uzS=B57SЖ> s~{\y3qCR$ !7yFm+:-+oCC7:ޙ/CG1q6wzwK✗~2'~i{Pb"9eVy0nj6#yBhZ*ԒNNkXZ]KצBMEsK,:{n98"<8\s4qym\C E&!pd}>8G~@67>opޥ(vrEo}w#z+f >2՜m=%O2{JU6qib椟dD]ۋ]ҝ,x9WըcOyw˾Z"M+Ǒ1ZV$?@6ye72I$XBaLU~^淙bۥ'>{dDv[v?kk1xy{wg& sqlثWS*aWfk6o5p+VV]\Uu\*Vv]qWf®]u2]O*re˟4y?t{R -VąZi#DbDZU.dT_ gx'ooIvhޭUIx'Nh5^n-^~>μxrYL{i!k!(\4>]({Osm[[j/&kh'1V[)'>u "=!+9($ M U^Ŋ# ]_0 C|-N|ẍrs=Rr?3/X6m嫴ӎh~0Oi;2b2ġ'; ?uygi3p6J=56hUS# #`h|Mf7}K d %8J1#]mLwCߛ7tz)yfW\6VV_Ohw$95h| m_Ӵ!k\|.@%3D\;ӹbC1E<1Yy}ByttmwQC|iM S-ם1<μT9fy@ 'O`o&O+h|uTQ-,p #Z V\{MNd3FGCP}bT DHQDl3O3kMyo1:m- 5EU7VSBe`H ~s~]yrVWzV+[=KSbhTA.C5X}7{/āFt+{f=^8~f濨i3yam6NpAkR]faP)zjy٨ +_q_Kn0&̢L)P%rƬKwl=d$#rYymjgMVy7{56:JZip!5)/_ӴQKzrɲnÕ?_.@~bk=.{#Id}H16V3E=F0 2iiyK>ˮi*;TGuy YⴷsEqGUׯG DzWNJE wB ;Fs9%gO#ygOmyt k%ơ/LyOwu'K+I+ w{c>̂,ew Sw(vrǓyƇd%^NfKx׵0tiO2:Ry[A+Im&i$zf?+kcխVHۥJۓf(H_g?\S1dV/.yv|r|n-_To)R9ҧgUNo)// M7n6\ΘX/!' EUTRFq?ܼ>мyz4 &XSԸ)Bhuisj>x42@HH \.˔aFmKȱjBcguM{yq" }[ڊ?9ߚϗ/5-b^GˍLT=7ߨϞ{S؝fb"4$%+<>힓SQ6?44ۻش-[KO4jmΟnHpR"6'zί[t錚Kv hj6*F}%aCW-@ѯ?0/2y~\5飒gN>5^ @ we9Wg5z4?D%B1Pooc㦛+ SmqHS]!fQ՛؍|Ʀc1#pcU:u/6Kz~8+_=#USO!:sW^ DmgSC%78}8⦑i-gigQq Vs<ۿm@! 1cOU^?7l[N/7aӬnFic\MvJ<ۖg%%G]Q}rp5/W3Ξ[յD[3zv;]>)"5}.) %~WZܶοgg{s%z~qcZs~vjwZ_M;OG[E65ڟkGUF?dilp"-ΧZꓩ˫d Vڵ*;A-aio-+IDE>Әaȸ1dJ@+}WSC+-cX H HчhO}_\yIb >9YM U􂲴qܒpRu/+y64[b:$`W7ӝ6r'ğ˶H^DQC=>!R9n??ҳbУRO,%A鹗zf?'L?S{c/3_%X)d?yTnf:fwg) "=B@3Wgc?ZktQnI[ ܚ^jO;̒Oѝ,1@8ҙ䦑+$UQG UrV]qVtˮvUpW.]́]UٱVWo5qW{e*UV]\UX`V]\ ثyGcΟ迗:EΥ'5Ie];Ո_jޛǨpZ@qϻ{La?cuo8MwXl3տhLY,p["j#4*lXgǹ%0&ŕ٘oA` %S B]vlUٱWgy4Kyz\k[& 2F3>5sH6? ܙ|OlaLĖLvy/??ϢaٱVWfo+w^u][\UX{k;7WS- ѵE1F?N~|nWRC[h¾gxOJ׶ӑ;ʯq hZ9~YAq4 Pҙ`Ty(5GQW+VyXٰR3ã;>9gB6#l~!!޷φ2~p]YK'P nvgH̐B V"Is@G$})r~B8Λn9Z@+8Oʮ*l*WeaWf\U\*UqWe6*jVWvl *Wf* V*­Vqk"-IFP#vlU`v, r**p8AWc dRrPvv(dWcCv^v0K)JӔN)v6qV[́]\UVV*Wfv]p+]L]v<RPUؠ8PUqK9YTy #92`YG vlUٱWeMWb|]lUAWc;d{aCU=Dv?vtʏ=S[lE%Љ-xѻN D8 /G:iq{VWLb41B&YUXGg槙n¤l1.yPoM%vvq(_|sk?fݦ5kˆnz}զni1qI0"}]t<=#]^K2l:ҹU,Z|s6Ӳ2qH?0{8J" lthӶxEii(tߊZ^UAϮ3 "cGjAm fOB rVqA.χˈu/-i+rM6戡k!޻.{;L4ǡv*"y앚Ğ8v9==*^vl*Wf®͊.ٰ/5pWvlU[m',cyHRRNFs#CNt+F~a,ycVD.ʶ( yI[?RGD4z-?qr?Ҩ܌}#>Ժ?awo|>.|.6v ClzQT-?Im!Jr؟dhG\=ivKO㟢%*7yOٻQ1N}0GieQ;ʟ,m{K9d?Μ(G-&W,P#r26~fy*I"k̿󐟗~Sw^l`v7H4 ƅoOl1;Dqk$;/eǗ6x scUFww=Ew.@Qut~ĺn|RXpFReYl;QֵVRk4%?:6R!Ê!G{|t\C>ih| -$V1Np0|nyWfnĈ}~D{_/glce1z~qj)E{_Ms7ok5..-t\$“#'HNmq{A<:Q0R$@V;ϐ]{~]ٲÆr"f0.Rg{GySw/5=<ìkWw *\_]*-Mő4_VT-$ɿ:5u4]lR`ήKS(M*;QZ2<e?IvG {#MDHſh3#?/íްRm w mIb?y~}~fyud(/&D'qR{tߚܷ|LJDGt@ L,,4GmX[F{ԖuA (?jg߿ikv$ydP%QPjzo{1ٿ|9{8˩>q$w/}BL6(mq?-@Qk !ªJʿ[ 0/Acc&1{S_?L[ϟ'ʺo&`V}Nt/yz]~Z -ܟߨ.Ϝ_>fP=ZMa9?TRD;SZu9FF<>3&$,]J&!AYoG?5ᰴ/,Z}йF=E*RH%e; 4ؠR-R.Gt3NiDMr{fw%vmD[W~_6-<>yd5*׌v6qYOkཪC,M >HoII~hygLǦh:-;_?/ߑz,^k ڐS߻Sz a5$Lo/D?euyAyGNb,$쾯{ `G[\|^?.0XgҴ`א[IJC$%@a *;sꓻ]iB̼D 4!gNm[%,,'{zUG?5a֭}D ̍)@Ƭ#^Rx+ga #3>fHC_--:J̢/ 2qɍ9u8{/̟70_.OZRilfX͔-~u.dH )K,gWtcy@V+B!{Ϸ{򾚯质jP?rҰ,NN_ژ$F7>|0G[O$>7Q:*]o[x4NFqkJQ8J Ω,Ϩ6uQѴvzB(΋W!d~\8vFYs?uWZ Iu+:;P-ӏޞO#yWĺZ$4pVƟFsz0)Gtr؇MiX5#9;I[68q~Z@j/yRY M4'psmdYD\8 "7}^uSg@cϽ:w$_RZ! ЊD~$ߕGgsx! pRVc]hqO  "teŠnjCho<Ѫ4W ]=7ي/(HFPSVj$耗%=))&]IFR*,G无@W5e"W8ǘ()|+ZqTUYv6oe5p2=LxAţN+x?86?"h.!Pm,`V_Omt?iy@<mqڸ_2ZaaSm+:_Md(xU~_ Ԓ8cP hF$ &@;ҧ<׭ۿ0n4/.h"ȋ]QU?:| Fd'/qeSom=Ycޔg/[7}oӢ{;XV5았9o٘#qyȒ~}G&OMP\hfnuDײ.`3kE(/OU|~i:M=#R;=IJ]ىRwЈ P FUfvjf[͊5qW ]]+W +v]qW ˮ*ˮ*UqW|늸]5qWfZ[\Uxͅ]hy%`vc*O`22h@G&Ϧ_Biz{'oiw=wlo>~T=OلmՅnHҀ/-;OiA~8l큫ǻ1'#_o<\yK'c~jcyY^U6 ޻gŏ)K1n4&(/jvnq f:;CR>/-u]^ (\r f*Z͊\ ,*២/x*Qސ-ҟmLڙcN x~p~uWIpMgʝ5ͯ6TғqpcUxٳ?iLJ4/+=`8n > ig8t͊bˮ*ʮv]qWf]|ͅ]vUqWf*]p+yWeWvjWS.XUu]͊1Vثc)v|*c_ {kUd9||\ (l?HKnn7~~"\+!c$J/dJ(hrR*P{~YɽvPUuKPW7 W;ov;FW/,>&#}ϩ14W<墹c=5qWf͊5qWf®\U٫\r4PII&moFґZ$sQŦIF#8̶ewT_ goW5iQ] k8UG_Îyb|x6\z4k}yѽ?pEyo}{-t&ȫ' @pm9O?oxL~Pr ނU7k7o Oמ?GxE[7]{ݳ{_}$v/|ĭM}+jo_9MK3DGGȒP ..A<2$}H%o<8+,HgoW$~{F- S1'!,ZXvK3ducł5Ȝ4# $&Vi:RqR>@+=T K,@w[qݾe+oDq 9qLp$E':Nuabyxzq11vT'=dGٝ|l@ C鏗9?oN _ 'M?1`zf=8+J?mA{zL6*,ֵ8M>Y[;Mk_//蟴P{/htHd%!%w~X{ntgV{60!R~s<KYn.ǩy$j:szŵc`QAR( 3_$׵=NJӈic Oyd J\1pe(ǟ!v|2K#4Le3fDԇa`>SԿ.{ mv k-6{0j>:^H p v=i+^N֭.,w7mQFe 켅TPC܍|}^xEc<8&F@K$xV进^i%ykRݼԮ WgT0I'IX0*-4OˋgboU;]VKÔY+Ͽ? <=_#Ϻt6K[] cYewh?g{2b,\MOnu^iqSҼiRY]c<[XSPrcubD!?5?%O;J4٤9^=Pƿ yQJ.^҄d|p&!{x~魥גغl:8b~O|nR=dII,}{O͚FI<>\)Ni/¯)=sN5i;IktWiLS4Ӧo}gLB [OrZOȋdZߗu ɞIӧ5+mKPbŭv i-\7ƮD@Өh~u(4i}̒ɧ =9OmD"5$vnu%:O襇Cd,㔓J圁/o{k@G1'Hv}0}!GL0̺ndVd0/B+hKShGaEf*9۔s?" 綻nt,A%#o!sbߗWxџRq_B<Wo4kRwNS+h=և~)5_3:}GWh JAGvHe[= t{m>K`I$Qr<>E.$d0kֈ:Oe:0j(GSs$o̍q-{9YDԃ~`CV&o=9/ů8kyZyR8[7JT#@t '9Âw'hF$9g|V?-Ϙhl֪ ňQRd>^QAM:Q֛ j Oן'F#ndCySЭuIYunZJܻVEhqMOTs>1[3]CǕXShud̞[frF@zAD,K(&;xB-Oz( Os#MOI f c$,FH΋R`Ha;qOibq2UΧ -T瞼?`k}I5WeR8aF0$ Cڪ3]\Y? .9SX|zW'¼хOWO;?-Wڽ1"̖8%B :3=ۅQ;)AZìʑk}+ncmQS29<#x3@tߙO,<>LjLvݐu?<֛wauD69N=!ٹl64< WP6jwbϖC54EOKnA+nsqdf51C]sq\za|#$q8[sC6BrK (ٲ!;543ZY(eWf]vlUٱWg~ fzZEXk=jrA}n?~mS>j~{af;jO~yf|LƮ?z~;Z3b\ ®\U<ثW;皸٫5qWgtGw\"蒂8jRA'wsrJ{X^hK8/?Zk6kwSo٨ͯx7f= xM?3:]Rq#r™<3l]W;5p%-Iָ8{pgҴۭZQv@Vh`xȈQ"eGrR%1,: Y r~oyF`{٢yM.G]QlsgW b\UZ͊6*ثWvj\U٫] 5qWf] 6*ثb]0A]ؠb xOLUSq1dtʼn-LN-x(vlR vX4]\ vlUxxU1KKDn]0v^;/ /6*+*{ЏPiZ.J.ܱ5M#v7;+vlUٱWeL]]]8ب ]]Hv.)v*v.v!|ܿsz 371xFG  e/3"''an%P _i/LdccqCWf]v=vB1Ke] *]wȔb02vA\*YF*Ow=DI4;590v7lR K1—cqKUjWc+eT;/7ȫ*~*x9Jp8c*x5īWeP* $g?2#.&)c u:$maNgJF? K ;qKCb͊VpWeqWe乫@k!.b  1*Xn+WcICGNk\*i8®\UثY6(vlU<.\P.隸v:ǃ.ǃoZo뀄c1a ;6*ثb͊ML+L *x5]v( peK ]һ(aCXpݱ­e2Aqc?X_KO6M+MGjW$Nh \=0ϒ=vL@P'4(pphsx;]D|(ۏzp 뜫cLm][j67:n9Z\C$3 Tu*ۍO9BbQ#!bbzQ<~E]O=dSgZr%FBK_9oZ"U loCw5Z7[wI׭%XrF<\ .Kkdi&" ,hrIEI EnLѼOs!;rT=nn@MFI3kp3̒'oar-DN3S4:o{; >"]+ޕ}6 OȎ Ak}e狻äiw&{Q5Ԝ/ymsOO,sD|_sǙ;lH;??~Z[;k VnC.-ZULax_7e"+xW? +5HW*&=l12ob4GpZU/I5OuQ\O!,-<\۞P-m2Qr~g9Wn5 A8|T4#ͩ\'rQȰIӭℿ4 _3MxE/IO!N4Z-q̬iҴwYMxZ-4h#Z}NlO\N f%4$D_PzepH |"eik=+ ,|qyeyݦ;&Iǣ8b#b* ]ˮ,g9L"zyn(BQE O2\UWf]7rc^>[v"[}}E;{;N^ )#'?s?13O N|ڷw)ixFKVVi$_i^buMs[ixLaUg **JAQSsKMj:ߔ|K^闖eۊ 兒2"z^y ԯ(OZh`J4jQAZn~#19)ψeK XF"s'{Y,ml`2OIS3.>0@'y!ű02?j~h{iVZ6g-~Σ\Y>c|#ZG_vv ?c/x>WrV1uMʷrV#cP}G2 *hk 6/_Coc3?Ud{ jwZf wf<|5'<0Wսi+%C@y]&kz:uq6קao.EYXmt{|'ӆ1Z"lJU/W=^ը͖8/px?@,&6y{>L=-}] ܹf>砦|'^e=#PK`V\QݞFXԆ]N0v^! 'P5эP`Kɓy̾{״y7Z+#"P{k}o=O/+yVsZI 7qhbHlxH ٯsl&) k3?1g.Q4 oKd8ߣH`.G T;w'XxfGk93Ht{ہ($#lj9_2$<5ŭ} Ve}ito` c}%-Ǿqgڸh|KF(_a\7?&B8^^{N[~fwIwz'. ̃ƀ?ošw|A`]-̲~wYQYB>:L? < G8M|ˋ.ڝom@Jy̟>bTO3aU8vUII'Ofa%]ed{>#v]6% #bI95o2ȳkpnYRxtFn{;*q#%.r?4=*HW{GV.Hř$ *" rQE0>I Ww\]ٱCb-{(w65p٫6)vj⮦jCW ];5p%٫͊]q\UٱWt͊6(w\إ٫́-fo5qVWvj\U٫sb\R[͊ٱWf*88 &C^EO h"gU x/wL;=f6a4A\*}Ͻ^ѣO啌ZV(e(KM3widjt uݽ]ԓ9tl|1]y6!˹gZѴ[m+RY;W\E1knn2;!m l3kzY#Kv\;2Y6 f}m)Gaz?nF[m=y V#p@Tc!gYѠӔq^١˩F)/yKnpٕvf@C vJ/vlUٱWf]v|XczŌ\ѮOuRO$,G쬉A^{!_ QK#?u]?l‗q;= c537z^lP.͊٫l®͊=8^zћVnh~罣DŽK;>˘(Fg4O׀Nos/4Fd v.,'<j|^8?+~]F^6(kjf(vjS5qWf(o5qKbu͊ٱWS6(o6*\إٱCyV`KaCWZ *1ثT x.*Pbu Uؠ1Wau#A [Qi,[0+v^;6Rif]]]8vl UZ< v*pB.͊6*c!v/gp#{d btmN)0v$qWcqCb͊6*r6BKPz.F*P RY<)v._U.$i% [-YBĀ7)&xbLU UpOQ*A$Vrt *0͡%A'!ӊ6*1WbݎDv(6] RUG|5v ]$2v*%-*c#]8 KY0Mr6f.x5 ,bc+—et.ŁvXUAC*qKv8ثثv8KWefS8An dl9; U仃\ݑOAgL; )6*ثUj'ev? ,b.jS eL*UWv*Ljq"pRN*V*aVWvj⭜Z͊[́ fvlRLu.㫊v< v<UTRbIZp>ccX䘻6*ثb͊V퀫` K r)v_L v,CfiK M~H|[rk2˫.#u8i@QNes1BY%2 ym]J(Lm䚅ėHŏ[]CDG|^d>~eM,tGcG@,c- DL:TNlUٱWf]$I,ch>O#]3%c;OWofSn(|/៘KCIuw/:_w~(~UyZw 2-b=3Xf9(ɯmp w\P GMJ6+&HsSW_X~~[&&xCqFѤ$".z>?㿘,MӀX% J?3i#^R^ٿN?8??ywpDf uymH4m<fl,)䎛l)8?9"<mξWY/u5 x)>$\P(dhe ч>>cda/uM$v&?Ԙ~X_wygn@rV~Tϯ??:_5KF{n%IZ* *(Q^"3Χ$N$Mv,zl#ٚ]N\X*B.B>?.EϘOГj}ͬQZg_TK4@3+:O~ѯ<+Fm/RN#&69#rj;o ,rrH= T{k;] n$C1blG'9V̋-ϺTzOK []B5wQ$mh'+7??,|yoYyoMKYhoVUu .A}aIe1y1N go*0I!#GB x%\29k¼cU3=FzːJDDLl/4b9PaP} 'if+i6.W^"MEg2F1cT~#BY>dR}f²i#oGiQKs7%4UA-fݧ0_}!A')|h3ͺoL Mֵ%q$zGk.kg(F$]rydhҽA$ ~e]|~SFnt kNi=cюk>̦ W?Lc a?#&"ћgDvq2Sؒ՟jcF+ ? 3B=VHث)4#ϱ!!a!QI͊6*Lثb3WvjZ\R꟒^eCw,4;qa1Hy7rxsL3iKjl~9G||-c &6`I#9v'h3?6?*u!;QY#]Vz!,M{;mԼثb|b͊k>w6NOI CWM3p5ݳ}2fm=n'Í!PBPO[gͿ =mx33t@vor<}ΟcØ?9Kʭjzur7>6*jW6*UU[\U6k6vlUٱVWw]qVVbS6*jKYubcWco7ǁ].)o*Ǧho Qhb.+L0v(0be)vlRrثإxٰفذ5/v;"eWef]v%"WAW`y?\aIrQ v[Nm&ZrlaQS"@m;ȧ`s;6*ثMWb|%v; ,ثv8a!CEE.TbY–WcI ck]\PثyXVbZU[]k+o6*f*]qKXqWe*PR()w|P A-c*8‡ppo#ݶmdS&;6*ثb͊V#]®jUG-E.@*E' N(v6_<5FKWxV?XJ"϶;SCZrY,e 7rHd` j;3R'x<֠R5vƕ5XxP~OAz,>$D*+A]ؒ&RJ˳[u  N18(I@>+R(|q 5Ɍ mTOY:a296y)hf`*6̸7%QL|#Rj=PwËkK+7A4̽- M)ieٲ4XȜMW,P`ӫ9MbvKª;%V^®1Zah1G愒J.oMO3v4D% ~C[/2۬qcCzuRy>0Kl?yWYWf]v>8Vĥ *rF&yd#Ȉ'g#KɪNJ2(HV<I5R0yr7J<.mgzח\#r>87W_y?df5X 3'0N-gaϋQ %N1b<ys>]kz7l}>[-JHΡ$1#!ۋcHj|>R2MзaRYNlWOv ݫF8R,H|cy?R_*ZAM0: W`Th_VQe SZԬ&>=Gfbş!q|s'bv)i0 ک}I\rԿF0~z6X5 ֤?@=e}8;94&Eì.Ǔ1`Iq]'/9f'3{EOkKe#,<8egCM9/ĩsƨ? {'˱Wb;+&2/`;c_><ۓ9&d~~o]ͤ@CcQD@cڭrw;#vտW I5qb~yDw~F.ۏH?!he?g˞vJ4Kko؍yWΗ@z2{CSmm~Y o痘h ki ("?ȟ|is٘dIxyYuM!ى<5If|TNsTΗOؚ]?xtGqeMӭ 9JRI=jsgM(ϖ3 lUثb|ثysWvlU\UUٱV*^*Uxb\U[f]YWebf[\UUxWf[͊LثYVb͊k/vlUUuZf[V*]qV镊w뗊5qVWvj͊:䇛=yu-WdԖNS 柶{sO\R=[iBP`"30}_O◓4B/|,!/2HNQuϚQۓ>!=VG8۟R=_[ܙOca_ 's)$`@ 2KXIڽ2 d7/_*׆ *(S2 bAN$R+JtȫDW51vd=)o]6*ث7W%hSs~RoEӵ I(*6bFyp|v?pyO7yrAc<*UUٱWf])E ֠TP'ư3?-bbd]_Af#><#%˽[(\' #N{;HZG5$rm<9pc8yv;6*$-8F6rK e\z? _,,K2ߡF'rmdS=1WeUaWcc\ baKt]]GA%.vh:`&\uq "KxSȐC®eLRv,*v*n)v9Z,RW,vvl]%]]!] ]v;6*+-=AF>!x;Y\_j"Z8&\'t9ho#.6(en*n(vlUٱWeLJv^v8Uv=5߮wK]q2pƓ\U[͊]vj͊6*Z\UثY6*lU,]*}qWe]LP =OlRx8x8ؠ8@p%ؠ82Xe(CZo#sB1k"aCb͊6*i]]*vvX=Wc |iO\m.ĝ)hU®ʮ(v0UZc _ɟ3~iEmJ 6qH붴k2bX˝ K зUvsGH ,S4nBY=1*^XBVb[W(+7Nb>!{vl0@D;rٜpጣwU |N E?CiOl6M%{RYcij)9IM5d8ʻ#Q"U~XUWlhkFP 1V)5HAZ/K ?NUIWT8jr؝WcSa/c%v5TwC)# 7aø6n;j@e)jS%!QLٿhMogauxP2?xf$|A=lggsCZn#f.0O3) NͼbErNƹP\ғO3Q^YJ(i)T QraYC)銤|b}bU~ 5_%T/Vy} <{{)<3NfGYg#8^Idmd'쨿;>[s=\[\ MArͪN<$T= i#c2_:啻?v?8#4d,SaUBڙ{S7D51ͯ)~3?眵fu=ḵαB7 · u2"O1Dg q/\_jGsYv_)F+`X+]ܻH@ΓM@~,}zE6qQsj_;1ǤZ1jKND?tM3s{c)LcU6<9ۨ75E@nΎl*o')wNJR6Y;Ƶ2A 矠ʯ*JQy'lRI1l{W?je9N莏M pmBSqvܘ V~MqYe21gwc@:Z}9 q>izS1+qch 8`We͊޸ũ9s{e!r..!>H?*m'_GF򷞤V.:v'?Las5Nbm=̢ٟk@Wvj́] 6*ثWw6*ثϱk^Nӯ$&}&[&Zzr< S!B!>df=fZ;#Iԇm+9:JГkvsEGcAO4'Qu'g?d+pȿ <#yLz|Q1/GҧL-Y)'j~T g1?1~)5 ~%~^4v\OZc!X[/jzʧn>xо\UٱVWn5qWf]vlU3bf[͊5qWf]͊6*ث+v;v^)v(<0+@1KXbaKj] ɬ&C3r?ak&etLR~*PTHWeWev? /]v( p%xK𫱤bebcթ]`WeJ/"eWef]ث3@Ө*t\|Cd/wdZ*|kӾMbcH.v;;,bQv逫Zbb@—`]VȒ`e[T2ɵ0 k h&݉KG?m7?1y+B]ȅv<]@"*[G#'p|=Jȧ`{:Q!66\DR-%PMv]1Wcv()v,J]WE]. hM`)R?/Ӄ].&/#װR a1rY'-`{aCUآv;; qWeK%`⠻'cv_\*f)v(KL p8xK p4*p8`Wf]:}xrr\}rbm؍~#4 96c)vV(vlUٱWcخv^v:m׶@KG' \v4*mqWf]/+ /vj͊6*|]vUqWe]6*j]*p81W{-bⁱKPqWbKB[4-%XP[Wf]vlUjil *o6Hv:Gæ %؁9%kN;NvVvl*ثWv~t[ZU_V="ݟ!אs?j/hfzgLJG O=Qg2䥘J#AnF&#j56|J8"Yw'%)+?z<%VqުQA?g%R(;}1ճ&O?Yc=V;KX$cc"@ zMqQw =P WPv]Xj{b",>i}†oP,l;kv;cWn0P,t2v:zffbo0Hf I#0^T,Iƛٽv<3?>Ü>8d?Hy=K~YE$ܑ,pIW>Ÿϴ@1 Sڸ_8ڋ5_rg5Oϖh'_O I-qBT+PtX=e $ۏH?!L@2NI8y~54#GfbJ`*=iI9qeY my$?po~뭰f0km cbNݷvf/w$#TN͞R?>|拲'w`VI5cK|{r3y/k{XhPzֲ=F$5iP)'/x:q<$bAyˮygaԞQygǦ#Lʉ$%Bf kZgc|ˬGRӠՑ^PPw.e;`a'O"FQ&%{_u6z6} 8ڍwc^WӼ$VZiY4ӴS YrW|f?hzsj+jMkH'R9RXqZ = Gj`_ijc{zp-Ÿ -pb@fhUuZ'=#oKpJ@+3KN!Z& ]LRdiWWEWeWf]vlU؟z} d(*SADP :iaV71[qeo_&J`1|$gj{f۲u1扮~Wӛܫܵw hQӾ~>u]>m&KAޢ&,$DAi 0UքPF6*]vlU٫6*Ux'$$V5.)o-0Mn׳2Q1x?ݘ*'E~GםS~bS =G΍B9x NP wkJ'Ͽzŧ\G!50ƛT 5k)tr늷.Wv}$ KFҵW*f$ ps=(N@!&Lh*CBPsDߙFз6!Bj9y3z&:xshF 8,]=Y*x 536oثYVbvlUXWf]/vV*㗊6*lUثbv;?*P RP Uبؠ ..=fx4ئ6)v8ثثhv( r UqWcٱK%`v)]v^)v^v4RRQWe]—e͊1v)o9~Cq ӱ=BS & ]d5*L aWcv< bœm)v _](%6P?d~9RQ6 3vD xW R).8?hl]ȥpLB]%LoE#,c-c2D_'aR:9k_ZzՏ펾PETɵ.1Wb1K`1Kx۶ FCNZ cbRvrڻ#ͺv.mk v<CWb#]bc—fcAv^)v<Wf"Rn)v*]Wc+؄;/x,bǃ v;"ǃ\J/v58* F*ROO̘ˈ5N8'(a׸C0mWZqcc%ػ6*ثDnW`xymG+N %';4Uʮ*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ev8U]]v*]LP x8ǃvG} o 2lvlUٱWf]V <&#iv @K)9%k\Pi8]6*j⮮uɭ{QEk[ۂ=I\GO@:柷{kdi)@iE۵t3OѴ+i6k DX('L>c,"d~&1 C;Չcͷ7uJg ~斲Ĵ\yh)WNNex & jg )<1 jqdR;er lR;bFҬbq *]Lw7j(zxIVeFq!Z2t8!rB!V 㗟e8 *oCI3*(f$ Z{}Jn(*HU7k}sGĸc%6׎zѨ/_ͣ򗓒2"lxh}{⼹эǟmE4J|yTs_MiltGVXm>8y*;Tq O\cOrm v-6?L~rտ^a'(7@ѝ6?c?VmvSE6O/Ӎm+KX/w̙y*ǿNãŇ,\ePtvdu$"ck]vlUٱWf]vj͊6*]vj͊6*ثb\U6*ثb͊6*ثbvlUٱWf]͊6*ثb͊6*vlUٱWW5qWf*ثb95qWf]vlU٫6*ثb͊5qWf]vlU٫6*]vj͊6*]vlU"<־T򝤷ڭ(-RP cjx\F1Ieԧ-Ƣ$蟐3h$:s?W?~ώ|o{`k.]0YML[:mž~Af ]i @TQ(s.V>g%ʞet77.CTT&#`OCi=(qoD_yYK8xb/.OioBdYBU5>hypg޲4$3LN*68|7o5-A#Ť[3䌫ļ2q*Q.|#ٙ2 @\[#nݣtjߧ$jln.Z[Bf&`48^#C"Hݘo?5/k l|93<. OQ?7EiG>q؎WV%Ŷ,uo'jcStf_CBVR `tPN"rceXMqʘ qP) J lUٱWf]y,U(1(YV˅Q={fDAh;zŚa*&[NYjO'୸`)udWV=[1"kTW_zF m 3_~rONN'@Xw(*Zp)C.HϲYϟY9VXJ74':!\պS>Yڙv,@w=vF4ߙ5i{kx<}_Ug!94$U~VM.t?OTyoCPot21+lAQņ^2V aŇ\+5A:dlHI.nmOjRRwo%=c;/IgRBDmWU_Unಳ ,h:XcℲ˂ȞZdDE;ig!PǠ8޿93MSZG^M]G+eT% 搄px |K-^82 ~_a%O$~N?7峼%QƖop}9C]#D@y;I~Fj+k_+,CPn"+O Wo09?? ])^@֙$y'#Sh<:[89?y;F{?vt:ohA9˿}3kH2yߞ^jsy-#YEkزٚyq @XϴkM!$g7,jdզI f!ur;#M #r=O5M>:zpƴE{S;) >Ub%o6*,U٫lPإsb͊6*ثWvj͊6*]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU٫6*ثb͊6*ثb>ٱWf]o6*lUٱVbf]vlUٱWf]vj͊5qWf]vlUٱWf]͊6*ثb͊6*f]bɯ?4_%y]CVpvcUF`3{Gg9HF#ϓ e? D31W9xE1$6rʐ 6$+@.'|A<7ߚ4뫿7vUNf>3;4ʐ6`yUxCEve*da1$@ #ԑט?E#Id ۩'+]KhKO3ZD ~4G.Kq q[ImOND)/U;n~[Ja|vY/]ڞc$o\̹;JGmG4!)CPR(91 R7f<8+̸^q$V.uȁCg<}lUٱWf]b͊5qWf]vlU͊6*ثb\qo/k0%ؠAኻQ]Jbbb\zCO X(i/v9OlR~6*x5])퀅v)WfL*ءx;6*rثإxٰ`q]]+bdP*Rثb"𕹏dO=V7uMd; ɡ>Sv*v-!WR>:9lv/Ųz$U'ivX=WcWe~cg`R[ x5] ~v8Rp8yٱWa^g/_qn»~Nˑ77p6 ݅mC)ؐUؠeqKo f;5L#3[+R6"'X;,byL] 0U4Ȑ0!{baWeKKزvX8beLR[vX8vvl v8]ǃ\Uiv; pcǚ]v)FTBݑy caZcN*n&n 0IC v=]*n휏6| '\UU +6*ثbf.͊5qWf]vj͊+v^(vlRثWe͊6(o5qKY]qWcWc)v<ءؠ5c*(-cb.劻/fN mOL NPثȆBzUtO'#͟'`7rƧJO5\UqWebZ9Wf(pϷO/-wLCU#5Sth<7 q_g?{+E_*6okϳ{^}}_2݌G Y 2^CY@D8ث):h{K2 GqIJf8_zqxuHE~"A N~g?yq O0k ZGsu,+JFÀ! )s%qCh@ȕNf0W\UXWf]vlUٱWf]b͊6*ثy͊6*ثbf -f]vV*Pثbf]b͊6(vV)v^*ثWe͊]5qWf*ثWo6*lUءإٱWf]WvlUثbbf*ثyVb]6*lPV)vlUu[͊;6)vj͊6*lPlRءإҿ*?)< $_{;lp42Jr~B5;/͞@'f<1A__CDLOϬZPu_"S:ߙWOѵ6ioZPk!FX1f⎨D1xD%L ஖i$`= cw|^O/,yZvzֱGoN"7!T,joVWƷO<>:4v43 5LC_&1i$--\:FY,u5&h87v2+n  /lNNj\UOȊ֖$g,>C--EMY"W2 Ð׵ICRc#~whihU7"8-Ň%"w9r7s3ys̟6FIcjZ}\q[.EӅXJUW|2&#o⣶R>pƿz4#Im۶YKxc{T-dEx"gY q+@iՔR( !#GC 0;kO;~o-,n'Rm=ʬ$LQU,Xk$ebsf,yBԵL[\Iqw<'i@zޙPiBA\[Pe^B& S=wh >;<$؅p~f.ryV^mHL8aBD*D8EZ3I' W|ūys̚+:#͕Mk"(cqx_w6' Q-I$ },zx×>gGwVtVnn}9 o+HE)>/׿Ⱥ {c{g!ӵKHK{s+5a|DsǵrC(I6W\J~;օw'frHbTZM)ZPGGo-]kZ^7̥$ToLj8Z(ϟlDF7${ޟ c_[(Z(%Mm-h}4nL=s$8`-JO)ᏩEe-D>#<9?=>Y|vzmwgcӟ_M|IޝΟ=v*fywyqu:M-ꮬv=o;Y5 ~mHmP>)Ϡ=OeC/sjuw=K#¿>&sɗLYؚ] ".z}Vf_<=m51c Ԃ•=ƿN9wy|#㟚% } s`ǭ? çM'bNɫS]GļI[$` VoqY巽O$?|.4};T2aT%}FgDzai>LxH-0浊ʺsHkł=#?Li(#^l ѿ,Ƴ ?>6 z~.Lw9vl;|o3o4W+O ")UT5C Xf~| lGk Q| qOZt~[|jOfo'0 ^|?K-K2ƂFɀ'#آb͊56*ثbϹ%SUүJsj<+Qc!7]7强w7֓zFڠHo~9{s_cZLn0Vr gki?*:׀bG]8VW}1cqS%4yNui͊6*lUO?K|]sNRS4=CUXG7~g^i~n$Xk OsoUVT1$@$&Q o 61?_;6M4V3Gxk3my6*lUثbf.]\UٱWf]vlUٱWe Ux]v(1Wbbb1VP0%xL ^Gv4$f,js[yX튻6*x5.`KLUئ*PQMv9 i͊/'f]S\Rvv^)vlRaWcqK]Cf]]ve}$ v\Aʮhu ZFIǁv*)v?@H.>Gv=DӲ$+Վ$P*p88_7?1 p4*p8`Wf]NˁC?hx ֗>Xˊ̥[>mDak!J+.Û;~#~$v,#쌉4/o~0xa&2;"5|ب5"aWev?Up'e ®ǩr$+x82vX4]œ]].+S$;]"cī+v8Wc+v;6*&A>d%[0]}k]\%;8dE]J&eIqWażK?#|0)؄s5 X8i5]' \Uثb]k+v^(vlUXUءٱKbbf]o6*lRlPlRثb*X;Wbc]*劻.S|UU Lbb$E;]6#v v!,{v‚]*p]CYxߟEyh]\h[!"CM:y׎,ynϳ^<o.4?ޙHbOOa5(QQQU@$g#)nI{ՁO f,K1&]2=wJe $'Jl:fNm9@${ pP!9,FyYU{%'n$/"[TiÃ-gב8pGB]>ŧ'" Uά6Ay'5(d[2^[C_Ή4%bWX3q]qq_^k:et{Sm3gt..BŤƧ:Fz-- GbXtI7@B1@li#M;Ah`NZ|Ht x=Ek#)dwz|8kIYo< Q׮56g@Kg#v|oπFt`,|vVpbuAye ~jF|]F8W,<綴]/Rhc2[3\_%CHU^n36gzp苉$|,O tr7stG4ɦw\_ˑ=ݍq%nٱP?t8~>zp~cfaybWZQX BXTKX@g+fvV$H Qj#yVnZ1$`oTN4RMKEU#Vԡ-"jČ90yYۙ( pO|uJy(v~a:XnG NTĒ)]jnU>ghG.UǦ2;Z&u$v0)ynG j:;P3' u(j!ciFmML*˄mN,- d~Cǜ2 +xGk3ÀǬwH/S 10HV[KcŮC~1Z5M8yڬɤe¬TfYXQ3RBivpb1=؄w"1Ǔn+7v_cb9s L u#1=̼ GUuu{uWܳFrIhB¡ġ2+@ڗK}743[1 ̀*%K|5%=_] cx`g2!0#?3`<X6cTvFUA6--hjm5khlu 3 etb]Cy/]_BRMe-2o2? P/’)f-pg<) }fGf0>!dGOqS{%sZGc n"L8Ș΁}9=e46h~qN&ITH*_ 2VWVזiG- aUd+R(A> % Apy[}PZ.^2Cq<Џ|2y kAd̨i-˪$'>JZDI&Y 1yPj'*ۊwϑ??wvCq)ZֿZ{/ky1:]_jW=?Ab[Du'_>.y7bRn%4]݉%=K 9: r-* <k3)Cyo}~ajiTc SF4?W8onazid[t,\j*+<[:gۙo٫~rvr5X|ѤzLҊI=s`mAq ?=ߥ%}?C% i5?6ó7Z͇"G7.2ҝ7 IfKAߟ<mu$D!m ?B!*+QxorcK[>qK;dwnF<Ѩ>q l2u|iL7wN)GqaؑL NJ}585[81E27t'zgqww7[͟P@h t:}@ t_慜ZGq*yI`zR cpA2CyKYCyKYXCWvlR˟/Z;_ݚ5X~ó왑>~iX֌n$UanB OsҼ7X޶c:w_/Xdҙ&cR.Gk>E⎫k\Ydk zCUD*>Igz_eebVC_v7\e% /`N|]cߓ`bc$n:7,:lmP?9Wf~XiHE$g3fJ\UءٱKyUZ]/;+o/;6*lUٱKXUUp[ǁ.Ǯ**)v(1WbuKA g&|Dv^**p5]]b/,bͅADv^v8ثPإxث@k.]]]#+Mv)]dP책]œSvjbclzy-ӰUba?Id/waq>`C8U1K;\)f-4`'d6鮜;5nkbTWeWeǓT?qK].Ǎ*i r=G@Yf2HjǮ^4c0WbxUkv<ؐvE. ® E+ءk/ ].Av^)v<We®bbݎ/ r$+v?v8Wc)v?"ǃ\%]]vF+/AxN.f v#ms_ɨ.zՏb JۈI@q7#~rL]*p+X*lUٱCb͊o6*إPUثbf]o6*ثYXyxbf]vlUإp5[W v8RP6*8U}qKWo5qWcUج Eڕ>~P&xA %&.ƓNk]o+5{+gZkQ{-= o,**tZmc}<yC<=`ݿO琈@jZzezgCEyD:VHWv1N|}s>Sr!"1yw%wpjjѓ>! M17jw#CHaEӖR۶gPvx%֝_2>LWMV\fT;q>lv͎ rHLT;JBDmjI>VɅh}kdC0٭٭5Nul'5cL{ 8r{`*r]m-2Qk{o-ʼE*C̍>iarDщf2)L.%C)3)]yzFw_\ 4(jTW}Yq x\0[cO"HD-^*lUثyVb͊[]vlUٱVf[͊vlUXxٱCYXyWe͊6*ثbf.͊͊6*V*UإٱCbZ]o6*lUإءٱVb͊6*lUثVWf-Z͊o+k6*^*lUٱKCyxYXVbeb͊];6*lUٱVb͊o?%?*;G~bmg~.mg*})S$/B8S<ih}k2b*#1!$Ӿz:@q|5=Q77(D['dv@8ξNA?6wwGwR$bS<Fwڽd!œOB0rN`9܇ `$#JRӦŋ(c rBc\&yu{=+\$v:7 ǞWHG H* |R$럘t<8"# ±p0e+LHmDDmUo-妄ePRUQpܼ@Ѱ4"~g]A{@o4[+x)$cC'À><#8fI4=lڅ}OQ{k"6A"JX\7I#<]}CD#·]۩Hͯ9#Q:n-y }z4BPP^C̛^Ui^ָ2[[<#<ȥ/u=^.xtL! 8826C@~ϖH ˠw+.?-|jcjSJ3-.c$ONS$P2«,J-+3Hʽbuu_(}дy+cZRHuo;O#Ej &OϪ{ LII:\Pg2<1#\5}].Ind9 ZXyev@*ZCs]Y٥=^Ye9lM GMHF.iMqy&{9G̒Mz#g/㮔R֚d5?e|]ziؽq3GF՘hOQp@?A?>HoyriPtF!YG7(eo~ Q߰n`q9s4zО} vJE8>CxkƗvq8 w9bqVKl?z}}B)mW#9i.ĂϟO{Ϳ6ҾV ڽ}*f^fMN连UpTzAa B 6l#GhLE@R(68LTmAF h<0.vz<*;xM\y,-f sH|{j Y[ 72F^j>YOws-7;lC})V$xmm~aBbt+(p*[ƒ}6PV1A)iRMJzQ@*g;ZPco?˱ic% 0فۿ\g? -iNJ'2ɢzxϘ}O/3yR_qOg~yo_󄷶nf򶮓A]>,Sݖ,>QӵkOitkQs]q?13 zzx`?\ Ls4 W#wCOW8sJGRӮ? _RNÎq3;}^v;EWծGpL3b]vV*t7y.wKQ0GO2x-lJ%U8/dV:gN@Zxe]v.onŋ~_$ K)$3rK͊vV*^*Z͊+o/vlUثyWf.]Z UxZnj oQbb1Vb0%S)k n=f`t5mRk!XU`q/ /v<] 1Wbإ{bbb ]v; eK*S]v^)v^v4RRU[] v26#e5n$;6*ث!]`WeWc* @k/]PwLUؠ5Wc(v?v^6)xp+.bWc+؄;/cWeG$%Wc*UP࣊{lRNdBV`[Á2E u5?v{IvW$qWckNvV;6*lUثb͊6*ثb͊6*lUثb͊vlUثb͊b͊vlRX[Wv8U`Wc—c`VV늻5qWer]?žĄV~?N p8yWf͊t6YIҡ{˙bgw4UP:NC.H≔,,Z챩 |~?-1?Y5) Zx'W`3n}=>6=gݟwyy[mZ~1-4AV{|nEpsUhT&$P){Ǿe݀G&#sυV$&SB~#?:C/t[ʾXM]}so{/ 9Ϙ~(02eC{wm2iG~|>g>D̏ yoVRs[6ơ$ߐ9❵:-NLLSz >O]Zv2!I@Qh”sl o V޹٘|XAV~^?xy&/1iJZt&?gdRGrIJN9b=PW1pd=wɗF{ELNT|g=-2ثVWfZ͊vlUثyVb͊vlUٱWf]k6*lUٱVb]vlUٱWf]vlUXWf]vlUٱVb]vlUٱWeb]vlUٱWeb͊.YVb͊6*ثYVb͊6*lUثb͊6*ثYVb͊6*ثb]6*lU2Ѵk0[Zzܫ BGsEUrIʳf̀O F&F$X! *I~? m?tߞ; h,"qSgV6qj~fGS>/SqK?c|&_ĭ:,'M]tlSohK ,"I*Q&F*}C"=$AR#۞ly?Q-HH *BWpXwe_#WV Z)tGO]&QbIy$H}GMץY|<%jSMzQ>L_Q)e5<4|9 ё4=nc>o)mv/>4rD|V{On@T_狽Y=ޫhPǦ7Wѵp*FY hX^G:4mu?*-{Ni`%_.iR"MJvfTpÕH<',LCɝLLjoÇO7)DǙGkԐ\wt;Y$hbImMFx]XגG$Ua889W5& AO_@~i/6&-3K8W '"ˎfOc0iaWI=;u$Zx4QGamRZ4{V|t&k=/& ]Sj̯rO3/;+8t˂ XuyǦO*"F}=gjG 4$$O dnxbEnb+me@ ߕd)֛-EְֺuKe1qt]"2JȷsoD VO8?85Ώ=c^5-X=TD 9Y#/gó8e销 Q'<høvkym.뻘ܶiGҬqohnš~-8EvG,QM(1H^ rǘF w/'e #3 x$*?Og:Y^WOy}bѽJ;oId8ͥUHA1IZG.O]m]1]5˻5hZYgf`MբDF!~y5Q("&xP8Q @sj}r!Qm|UT84qYܿ,qꟗ{gR=ǚ<IGE?TVP6 A/j}W#Dٽ(>=( * BdD3Oeg}G$QGn"c+%-"w's}wv}>̐` n14XfbP:OAql9i:@3g_fȿVKꆲu޺5c;fy+6o5}^n{yoȦ@Ӌ7ρ~r]yWjI1'=Gǣ1b@rVF[Hנe0V[Z͊v ӵ+"=KKnQ|A A!`)J9T2Cm^zWWxqZvL!7ᑔ~civ[PNX$J8ӮApl.fi1C_]^BÛ@B6"_U;qX7a {r>"o0MVPi^NiFQTem烙DD.J\_Dm&;Ad|ke+\Ȏ/?,솗nRPTzgϺQ[1ļfc@q-= #]Ty~4Q4Lj7f?e+HʑQɩizIA04=ljh:9K'Ȓ=X.ftRa|jXٸqRT14PECHO`ӯ9@xOϖbrͧy!&$s#TlZߐԼ3)])_>k~}~IRs-I/瑚'd\N05sGߓߙcVMzF{5BO[͊o6*!bgp/yZq.tvC s"jomٹ$_?Y6]mR׏Vv K!N|"B~_yD/ zr0 Kf$9tGw?uͤYkGyokRq\y{dWebgM\GS˭Wm|SXǙ/ӋID{ #-ŭ2? zQO|Djڝ,RS 2ޘkfҽ+/vlUٱVb͊+o6*UٱWf], UPp0+X1KxEؠ] RUFk nk1o 0vlUٱWf]SL+\ *v?v^*rإ vlUk/ 2 ثv^;6Rif]] ]Jbe{Wbyo]]C]Y;.٩50x78AWf trLi 6#կV.GRݛvlUٱWcթ逅v)]?`XTaWfc`Wc*p4B]K]͊  W2wl&'ԁ?\X}l+&a[IJ+/C7dk.kvlUٱWf]v(Wc+v?v85v<Ri.;,bBȫ(v?v^fc)`]F(o]]+c]WeLylUv?p4]]İr~_0mXZ^WeW ']®͊͊vlUqVb͊6*ثb͊6*ثYVWvlUٱVb]vlUٱWf]vlUٱWeL v? \ x®͊]S5qWebf\UWf]6(vlUٱWgAr#z ~e eR5al?'/|9eI##Ie޴g rs?ymG^9ϤYWf]YVb͊6*ثb͊6*ثb͊6*ثb͊6*]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]k6*lUٱWf]vlUٱWf]vlUٱWfZ͊k6*ثyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v9e0Y؀$ һ?D/Szrm~fڏ--&E'Nz _*/m?]9OC;Qٚq˙S0}f~&ϧY<Þ0?g:ֳj _ &`PF@#2| w=}>Lw Ijo{j{7yqJ4K0-GBNn5"8~CyBoiwW~H7I4rNJR߲gyv^`ks~N&} qF=z^=9NGWzk]U%pȑ!AVMؓ˿!#~lנm7]קWykc%?摲@ (R?uN֗ha rG ezN,4Π E}'s2mߤz|3jzޟn(TfeibNjuzo8qGcyr٥Srx2 O݀#M1 q\ U߸/eJ%"Ip<\V}1 "<瘿+.Ut>}ER4ky/V9cfq+nO0RQ_g|mf=Kq1ٛ`sB( eo9G?h>3L$7 b.8H>i;?YdSIe1Q#".''k?!ɠ >N:ij.-<Y ʮVJBZu258?L_=X Hmݟk#ogɔҕ7Hě6o[`Y~_Cr9W|_^Lʿ V%hL$n s! 9.>b=2^1Z@|ey6|>B )H+@P8 <$WF֋,YBĈ RfhezEty%4AXߙuAouF"usj١TH?U2S'ZiV >o*DuOnah4ӗοr ]aQ#!'BM-ܨYX`Z>X]/Ka$D16VeqJ/0hInk3-EUXEYWQ1L#@.g!-]yZ]ZILX{{%YO!1Q RG;_+J4|{͞0O5)faJo,k$~ϞyN[͊6*ثb͊oiƕs\$nYMAN DE F;C"u= B3C8淓l5uꯡv&#4pp/_g,w,&3[=(v9Y/(gZ(Mľn}Ce%]M+xh^:&n#d5~Y` 4h5'|&ҚOZ;d4д/:EkXfSnEk7CF}1޿Z r3mrTWr =,i&,ΎzCɁPw abhZbzo$c[^Eƴ-½FR×{-+%>A835 ǩ_M5O,$KIVC 9i鿜ybm#Y}bT82hVxXY=͢*Ho)%4 qc}j]}Τp>r }[[D:ԑ麯%(ȭ`cb>m.iGz@_sOyWSl,4@_\I6];K'̼f|4W}zl iQOr~yhҍsϼ2/94}6PvNz_tkggDo"9dz2ef1Ӥ,*CobPБ^g9ŋz-=-%ZCjǖ2N+\j;mUxX V!Oi"KTF mÛ K`Ďw6=rl~> 柒AQլf_RVB7 v~2n,5De8;.'nS߼Jz}4!uz-!ۖI{vgg'>i'.ZemGs >&{vM-nG \g6saZi<Ūh-BYZ+Y.!XUR i'ic` \A(\DQY,~ȫi~ "XOvZ$,ߩό^G/&_͝ڌ lJ$@T 4K+Q~>,33>8hzeA@jq"@VHsy yBЎLC Via&2~#M6gi{3,XČf"#rH9|e_Ms]ZjeyKFN-5X !A PZf4gl=ltm#VpյHvmqR3*AYQ(9XfF^<C DDs2O+8WM^WIz͓D$OIF䀏fY=C/e]WD-=ݼPRppjȐqYL.OdSO=]sr$J`.kڬE Ǵ:/o ;:&.è[37Bꅟ1sмˢ[^JO}gPMt6"*qPԀ\9?%ij.#)/A"1lxr{SǶ5rOza}7#~iF|jQUo[ۨbD$IRN98ۡqgN/?-ΨIl ڹ2&lUٱWf] W%4!H{Iiظ}ǼsU~`SOC8au#Mǽ1 t6Kq>~׼de]I##C(W>g<ثbϤ_֯-dR#kx$w?cꏸA}96ӒTsXou3WհE{f߰b۽ox`$Vqs;Txo7.lUٱWf*ثb͊6*ثb1Wccv(Uؠ@0%شi J{AR-t1G#IUٱWf]vlUٱWbHWcWeWc튻6*x5.`KLUئ*PQMvȐ`WeLU(vlR vlUؠ5...J]SC@pJP v8 UY;51WeLP4oeS] nb2L]#vlUٱWbIvNmS<* v8!]Ur%]HE]v|cMR6Рmɤ;)v(a]!ċKt~O'Qj"Cb͊6*i]]E]]*v !CN ®ǩr$+x5]]*v,*v*n)v9Zbb`cdRx8] Wev?POL]r4#nCWcqC](vlUٱVVWf]/vj]6*ث/vV*ثb]vlUXWf]/vV*UٱWf]vX8CW7*ثWvjeWN+;6*ثbι5~|yOEzLv,EQGnv.>S=o9"]Nv^=7^)M?0G49lg}ڹ{W<#= # Dbu ðҢZֽ|̷!1Iɿ"#N[*nh;[!9!Z 3?,O;'<.=7w$}/T37 =YEO'+to3ں\X[veҍ/\PrWaOj6p9oՕg3@\ YF\&œQoV>P0,4zGƒgȝ:,0c{l9]G=Zm|}$q{@P@x1/DLl[a"ZdWbA+8B?+fm,XޔΤYRrsunCR#~<>Sǁգte0N,C)Sn3p?:ľpVw}wĐ\m AmRTK ~딒?[ue*ôӖq_ODFL8逖?U]/ŤoO2<{U[t-3)73RZNl0w|9-|p5<׶Qݥơ)勇jR% NC:epF"02) %9\JGlv&Wj}b*\z\c7,h!o 2K{4 #޵*)^h>NӬt&rjl< ev~kૈȋzB|.Svi`:HD13dЌ#Na dLq<ݙ:m&pLYGF { :r gWuQNĐ+dN 5-ʯ&HyrKd4vdʯ#3ƌ!#RU!#jv4⑯`@xP%$ I&3Dnhߖo/0?j״ 5ձkU1Z(#VxҟU~ykm埕%>RF~,+2J}Ek7s{/V0j K ߊvfgDY }Q^b~\_uq=#Nֵ #{B{Vk" $>1rȮms7:rH^X |lDV;泴5%Ǧ;w=٣ O"̭yU$}rU 1YЁ7P|"m9 )Ri??Ec{\<{a Y`x|x>Hٵ:h0D%!gnT|[cS%/Ӽ9絀5RVE?aNNRrc/k~_b4%Ӡ-Ӝ՜Z-{߲a,\gY;<z.!Sޛ398lUٱWf]v^*UxWe͊,Gb:UkȦ9*B}C_&ڋyk:wKT|9.M/sqۭKOl 𪞞gt1r֥CTz֘dyWqdZ3:KMO /B\ViYB ֋P+ &Ɠ穉$e|i%*iHc܍4W54jnTP7p;>!'~fyRR +xkE ʼ[Z Y0/r?Zq/аC̣mdR<doe3U'bIFbXEJ}SlkP׮u' -6dzazN6oĔ+>X?/ݖg &?PuQ͎Uquvola.TO2"3bꟶWe͊$^Q5u4l.#6(e: r"㙁K$V9Qҿ[_څVӯ%>Gđy?d:Mg=,X@?&|ͮzŪp^ҘKxn[TRWiFy$[vm]sb]vV*UXWf]*pvv8 U0+ ]v()v(v( a ! 9TnVH𞸂NrcxdSvFrMN͊6*ثb͊6*YMr%]/  qWcWf@k..v?vl(v* r$++]‡f.fPk.͊1Hv8a1v`1dY 69]ȫaWf#b3E']&HnA1ד;Q"rc,݄d;#vV*ثb8Gn~b۾v?1v^%CKvX4]]#]*v2ǫ `׎X\6)v8Uؠ8ؠ8x1Cqb׶{W 2*E"L V#b3!Xb͊6*r`!]WeWc*vU{`!! v<(v^*QMr$RRp8ecvY ]#v8S1v^*Rp5ȐLUUr%]ڍ[xeV.Žce]*mqWcqCWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUxu]\U٫٫*͊6*ثFѯ{[Kyr8` F*͚8bg2QI%2JBܓ?Q?I(r'g"wVϖ]<'p^=vH4ߙ1k-\==u9N{$IcQU)Zֵ]HCV;w|EW*:?4^O$Z;&㳵jX}?`=W =ӗH9|x1o4[xw{럚$i;Ԓzs@+`e Lfo6*ثE>ғ_WB{1zZP*0o>zof .f އĠx{1%Tl}7%*\v2/ ̲5o'ME=∲/&~{ 6cHb2&_fO\j?ݎNmKPG5gw%$@F0b9F1<eȡ" (g_M_&uø-8}f*-;ɟ"k;_فz,#H9aq?Z QyLʼn?XW؏v}qd_NygƟlَ3闅#OhxүɓK/qߨ؀=6gE $ ~13{ν/6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*8 8I/&捣'l3)S#NYp;2M?<&?Nn߳{?p%G8 ATEa|4mfxăJ`Ȳ3Jam $e5bz2]Jᥴ5ƈl'@ LIQG%)hչ;G8.AJѲ&*jLvS5xH=ڱ5? Q([WNydZ<%C PS۸qBzx)6㕱"}6Eִ_q!'_5%ȼJ1♕\3$8C) p)jBr@ܾ][Ig4 Xe4#7:v]ջEWVaPq U_6*ثb_'"N̓OKB1~itM2oRCvfr`<ETҲ/*">AYy.? iZi<FRCٙl17`n;bS*_>r@\YG2Sp}\gf튻>:rHNZOŅ?m?69s=f0O9 3:2!@Xzh >jKj~`j:ΨTTQ9'ŜѺok/[j7Szp\3ثb͊6*ثb͊6*pPpc®bb]1W`WaKS@m:s4[;;b:+{;{c8vq-nWf]vlUٱWeMWbqWeWeǃ\Ux*S]lUU`4;Weǃ\UxPؔ/] 1Wb]U1K)v..ŀv< +f (rqK~5۱HӀȓlcCA"݉A)dFJӰ o V+epl®]v(>㊻?JFAcWcī.U{bw^g(c#NrصqKbǃ]]7źiTA|C!*\ثb͊6*z68WbxUk/*P!.c; 1Wb#]UxRp8ecvb0RYZ< vv;eT;,bc*qW`K˯Ex'?J"Ӳ?ާ,`p]N(v6Wf]vlUXWf]vV*UٱWf]vlUٱWf]vlUXWf]vlUٱWf]vlUXWf]vlUٱWf]vlRثWf];6*ثb͊7\Uh'tq`5ViPʿoy{x'}Oa>Y.t~%r?!ԟpjϘale!Vcw憷K3u-Jc!Z "@z"-9d^>>!Q͘呑 (|)Or~yγbԋ]6*3>O&~o'd  _u#o'q9k}gj;;)1dMY!}c|C6s$r n̈~LbzcmiRWqr(daAg牌PO8Q>b@a10$9efAFRAg OͿʟ4y#nf{E?m{ Qe{O;]7 $-f/a^}FC~GcgMQ q^olnvlUٱWeb]vlUٱWeb]vlUٱWf]vV*ثWf]vlUٱWf]vlUٱWf]vV*UٱWf]vlUٱWf]/vV*UٱWf]vlUٱWf]/vlUٱWeb]vlUٱWf]/vlUٱWf]vlUٱWeb]vlU+`-G%^H }썇sϽ=G,lkIЂra ,h%- ;M6$G *3|fs7)$$\b"(;.uo4o,kyQYm#.5Gj_ YjSS%ԏsr$1ww%I$I=N~cq@ {%EccCm ,qEDEUU( 8?0Tf/-.jΠFMO4^$ˣk)iXܶ > A k>v×11NƯΝOPy|k+}MU5](V'>1ω}m=(hU}Z&bE n#|9%USy3SGqX|h)'1Ȱgezbi6,Z NZhOLpLyчI8@Tdd"yvb6 y }ֈo6MsʟVmVӂtb6HfTYEx0 7>Jt_,Q<RբӗOH.jZBQZgn|vNK=S\vXNa<m(&^|Nߥi\^4ZE%U#j!W?x^q^ew/m>*VY xg0xvn0 qF"y%ǔ)NFJrvس~^'.Nr:w}ʰyfmP\C,:T<%dj *)@|T50zu,vo$܎nwc]1F22mɿ::َSgo!6)c 9IcOsͩvV*UXWf]vV*UٱWf]vlUٱWg/Oet4o#MI܎5ڜwLQ?'?5m^U'􄜮4&6}|n×W;| @rߙ'<ˡE>&yoaY%wruae>2ϛ|F q_ 4De'^*ŏF'ZNO\V ">A.|21,|)O j;GӤz9yϥ5kff9!%vcϹ55HꋹCL1XnTe¼6"*;`m$cщ_ҵh|{z*0#IOa$ͳU|__1oxZƥ$p|?g_ݝ dx~uٶ"wwޛ5yEo(dCG˿[]f9XRT/BEeȊvbFo;4؆8?U 荼38?-t{(I=ݽռh hǰj>zq^X}V[dmT*hsfsDuy#&!bf]#SZ\)P{Kյząl6$tNJ[>iZ >ywMӼ(u[g rm8cv٦zW '^A!)?6nnu4:yUts0 ͺj7 \cZ=z@gDV6go uj(Gثb͊6*ثb͊, Rx]*P v(*T bb1Wbbc A.t9+%C`8*D;޽d@vE+$&|=4'aLeb͊6*ثb) W/ 04]].Kbǃ\UxPrbB+bǃ\*P!xzaK\ 1K@1K@0``K@<0%!7]chvr>t5NGOȒ8;6*JD*:;m*6߁,OB)6b}U>#a!Na]͊`.Ml~cH. 7.Łp!*p8 @^-Ӱ.C_7ck]qK]).A]\ v**J,}xzASbثb͊6*QZWc*~*p9.j\] 0%ا\(vX4ąv+WeLP~*)vl v<eLU ;Kذ50;Wf.Wc'@^i˒jNZ["pCb]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWe]6*UٱWf]v} K ?5BWZ%%4|K 'Ny}{0k#S.#}[!'"@iHbX㶉mUHB*U:3K26^$jzMSS;ia!dj(#'-N?$R0~vU\L?(?VF䷔3ẽ_I6g8_;rdXt_5~,!y?Du~QzYlUٱWf]vL.7|ѣCͥ_[*@&' BF0GF5gL~a$%܇]C%tu+o~n47z:78%@îLeϜ #F6`q+~K^usџȄCM(=a!ڍ 2rbuzom͊?G?󁿘'VYL{//ht'PlXǣ(,>9n4$i~OvZ>oKEUQOZ\S9r)H%!Cx̍8?ߝ<OUc 8N?UG <L}֝&Q>s|9]1q+3ro7GzHiV=݇.T ^DKZv#=A)NOKvK.aey_??JӼ_Pu6ZxĴqU~%Id4!| _}R-yx- ACO7^μO/~fiySmϻG<]He3w̺&uGbӗr sa"J|GAq=mS96~~b"B0{%HUsELd]3pc&h39H$zCN8#@g_Pa@İA$!9QSkAlOϏ47[ج}+xA"{*w9݉ظ{#PYA,4:2Q'$ͻB?6*ثb͊6*ثb͊6*ثb͊6*ثbǤ>ƘEqG+C_OG1$¬hߎQΦrs+SE@tUQST:gO(G}E _毕F] C#sSW'(֕w"(mh]@@'mՠ$،8EloN*lָI/=1F*)F,PY׎zsE-X{&7$[l"`%xke$3-%͓Պ^@ԍ^eȴ'XV`vhJ' ɿL~BDZW\ )vw񿅑YA,c#8~YI6OK:6#fZ(~WՂBM/*@xS+mO0u;‰sR8=s~|ӯ{W2iwRjGvPzҽ<3/m9hbMn|X5λbZ Jzv$ufRy#JNkR cO!zU3Md'Oi|y>K'S ?e8_'>_hʗ)ӄSR(߾ܨp/?\]hV):s+ eϑ|ˢDIabܕ3}alay?i<3ƒyzKki0-;t$ _SHIqf~+4 HӨb(lsVڵ%y4Я';g`i`)‡eb͊6*ثbǫScv)]] 1WcWf]S.͊7]ǩpUف*S;/0RCWb{bX v8`Hv* ] .S)v #]׷^hS J1Gn k3"xٱWf]ONXoƒ ѲIgdzxZ61)Ɇ) (v4Rn(v(>]Hlc]V$;]w A-mSY6BX Wev<RPUب8ب8@p%تU=L9v9T2vF/m Ӫrڈ`<vlUٱWf])G] 1WcWeL<ئE;]SM$+Lv8ثUxRv,*~*iji]u®ƳKnI37#Ӱ@mUÊ'+;+vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]w7k\ǔS&M34Q۽4e9@=|.&G9emG3o%vj]Dy@=e7jiOgK~4/SLi?^7gӺ5ivYi^iR~ }K\LXc'Nb hFZnx|/?I7Y5ˏLUm㡑9?ɒ+]5퍽[~|" B%x hd baLJPrN&Ff'.Lbc.-o=[Q{maJh> 4/"E7~D5Qz~:Fy_VnqGb8GɇD|XNc}Ü]]_i<g :gksf\rKRN䓟JO*,n*ثb͊6*ث>>/g2yv]:NF"8~|$vwD"@$=gee]<["(>gcXҎ/51Cs[1?rgw,˳'[&!zI ~DRukov+z͊>Ϯ0Gy?WoH;8`ͰոH;^/'l@o$dO8けl'K/{,G0?=Yon>?R9Оb9~aj>ZݱM.tPR'wY{;RK.N;;_o5:ϋYn9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWguo8A=^ جڭ 0Rv27EOA~c-9-v{W/G:WN& C+l~///yȶeG(ש?i9hv]~S9┹!<11uu-spܤcRrp !+ߟ_u~ah^dGctգhf7_!T|\@؟f/~}`1dcሟ$HxO-ڝ97MOK;P|"iC<`FW9?)uD :h8j(.˟n78{eI^\@f(IܘHdC[y-$?2E_scV!?vx9LsYK}şoݿ] ,uٹjJCh=?GG;3|~->iq—1|nwS?5,iݧUMʒ3??"+ḦY$q %1Jggz(vI%7>??8IKVM;OV[鲨G37;7ngp)t_phco˳jrHm3ϟ3Ϸ&kXaRD6Q>^F z7ϨyqIvQ'&ͻJ;6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*15[Xӛʹ,mj0iM=մwip9E"aϲ_6?"ZjE)v4pGk5n ø]7ᕗo3<9i.k$ϩ1}}8q뵽O}}W^mopAyH$;mpLثb͊6*ثWc]1Wcv< RT UتRT RP uxJ;4h\ӾD݃m]].A.:qWbx$  Umn}v[4LcqGSB2M$;Cb͊6*ثb!]]]*v*ث@k].aCE5"B]v] *챊.$.].ŀ.bœ=LdibivE®.͊6* c`鷆HSUCQOndjD2ACbc?1qWgEl~cv_\*f)v(KL u|qCT}.a]\U٫1Wc..A].őHM]9P"ݑIhF\ NİٱWf]vX4v, wv^v8ث؂ Ȳv9Ol(v; Dv?2vX4Cزv8ثثjlzbbvX8CP_? v'$JUP죊]͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثbVw^hLM=n${@^\9Op ]529$38W8a8V)Tg{Y>|(#~ ~g|í69HCDa ƴ7`ߟwԺzadSҡGWzQŊzQ7iAR͔W|,pg.J:(h1;L4.mbqioW y̾qп[K{h#D iQh=Ó&?؝V6s.y&y.C,@ewpAkZJ$)fcN~?%t%yM+-P܀zDV7l,FX"O?lg[P]!sOy<-ꏬ]='D_Q\~i~eXԿ1<:Ai#wvg}3GO\~C>A͔b!,lԮVcA7枳S#rf.XGx*(xz[v?ec'?YcQџm4~jCJpQ!;wƯ/? .9g8w-PMޅrJOrD7™4&}/Q6I"1VS S V8D %9X#ȃo&&01ѵ/0:\Eum w*͚l  smiMžw/j{;.%zr^]2\ utdeoR73/|8yCpl6U+RE::V?N~{kOg{C&$LxdhH1@bx ˟?ןNO2ߣ.Z0⿴oN^K۝N;--7 Ӿ dT:Q_^RZ=[Ȫz(gcFn =HǼFxh:oNj^uvvZqś`>0.]#<{tf㎘]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU>ANf+[gxɣ!y^9QچKwTVF5}O-ZI *3A8wo r^M֯tWIz *3"/9E+JS0M;SXbFJH*`ݫCmsNR$Yk㙘rP7y;̇G{ #[LD'(hF &ۙSSCpcYcRl[i͗䀤R=)t{L4U;L(P'YI#ㅗ6j=J)麐 ,L(}YuzAȂ{fqSoMNu%T}ue+ft5WJMJG.~ўT~mꖡC'ӭ wSo6^Ia@"ZodD>b򝏘zWSEZS'BA0Kּ~5; ፩ˋ1=g(+FjA:>o%ǔ J0ۖ~i-d[+VX`{49y)HC*O:R;*3kfQ(e/5?E~y?_xc._P[mQ-Jns[<?o&nkiQ;C쾤fƉ<>|uBk#1LsЧI8ېC|=g.9#zdj n]ͺ1$U< v^"v#9w>^iQ 2|󡌸U\V*0$͊6*ثWc.ǁ]v(v*v(8 CǛltDNAcB]CPqKPqKr8Jwv&ctaneQ$(۲$d]aWf]vlUٱWf])E]/  qWcWf@k..v?v_L(v( r$+S]ؠ]KBHv*)v,N{kN,%,PaI4K3\cӰmشÑ,b챀!xUxٱWe]Dn;/PYd|p tH5# ?)vBl0_xk])v7V_ Ivv ]]v^)v8UqWbKPqWbbbqWbѹC\eڋlt?" )싐TmZ6*ثb) W/  qWcǃc%pxE5ȑJv(v<aK`K]]g|)v3v*)vֿN,v2A"pGv7+;6*ثqWMK4O!ýAү.tb Ro/|z*T֤T&Y[o1)YT'F|6h%k͙(&M0.,Z-*#I!OFxH[[)WWqdy8&I 7F ]fLg$4Uڄijcܟaϯ={3cZadLvEV=]Wo o_hsّ⑩fEO>ZrD#2Jzr^դiP h7cv>?>Ͻ4uVLR.oj8>w_'Gϕ+'lŷ8`?WCOidxQ7y=.ejߺB?io,rz#{B'|?(C-A+|ٙ.Z6.Wfm+}oeƃdF\vė>/'h}8j_ϘYf]vlUٱWf]vlU!0$adQj0K!}2dNIGovx &LF>6_b]ڋYO?^:isO vtu =5ϒ#a-$C7^DAgȾ|'xU!^1 ?胰zORp|&$>4#ElR!?:o3Lsbg7,i=K#bjMŵ`NDg}B~ktj͈b>;U<'֨ }=PvMCOW/+{EUs␜y݉S`è5 !_Fc}6hUK*yB}غcǯ^{4{mڂ~}fѥvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU&'S֭5;Hc?3m2:eQ_MHk5@Hr~SڥqS:֣G3JGcH&nCQ~Ao/~n+,i!P*+hxJ-e{\GRcK{3ڙDgɉyqq6㾻y֊dn~#µ$ids61\C3I,۔R ocLY*Q?:};, 6>~򛱱JRPKi$2'0%H$ ǡb<](.X'DA#pPEj}gq,Wp?xR؂Aς?4'4]+#es?Y,7e S"(3c '=Axgyq͓<^WcniЮ_`m>Wdwڏ5+o.yvp3@RI@$}?ڝ0KS8 ?I'`1c9$#dOtO4LW3* tܳT* 1V_Hƹ|׳ʥw༸w#z(hoviqMaq)d?T盼9#q/^sk?њQ'֚+Dd[),B$*B:gN!'C ~ghs[wKkZ _v=vogvn^4:K!4Sퟗɯo2KO3yMh9'oWna,>=w:\ˠ{Əã!w;'gqS|ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثoXgc/yIf w~QIhsc~iS#̉: !*ݾ}EY5S4Ή~)jfW (w H4  c@ NT?E)ĢaarBl֜2z`qRq\H Ɣs?Sj~[~a'aK w`vO~Íew嶩e'|lOMh(Peߞ#GT# Y1Rg>/KgĿssy$P^@˧I94d5- |:<<=)n<Qq:?IH||a$xkfۉ!A韟/(?Ew;YX)zx&|GaO2y+HV.[Gu-{p;t&0VZ{zʾ'*دNf /[8rQk\L֒,O>fϡ?"Zy˟vB]Ybܨus_/& wqWgeڸD]#qL XuhP@})g~O|( ^O3WϓڴW F;~yӿGuhe.ClYy7=~rH:]-*V@ 8E+Y"_+4zlD\Mv=k:C;rD0H V̎ (Ɏ%;kgr 뿆E8^BuCyة# w>BYMes#4k!RjEő%{k.mFgTFߠ2I0ȗw^Hx_s_kU\ũY\@6'mFszc()T@GY#jmV7yх,1̘chFIJʒQ0a rU1ujWc.dž푤;v*bب8W*CL;#Z>|~kz#w2MnWf]vlUٱWeMWb|6v^*x5],b02vlU{bb a"XoWcWbk%ب@0]`bȵbą8@\p4۱4N~"J~NU]WeCxbƲK01V2AӰnq 2`iHd;a)v?dǃ\R )v?()v!,.v`G qWebeb\UcvX8U{`WbbA.A.A]!ǦFA.z1>"AA56*ثb͊M0+v^ v<Cv( r*p4—fc)x aK d6 v;vbG 'vQaqc һw#i`e$<˥yjy ,RS׶w,!~ey7:rX"Bڵyl2gorx*?.*KH8Znsh~ku>clm,ے8=^* ult</|c1yvc@rKUAjoK]V3*GB[?d_G:;K@+cǯ:O%f~Z,yjv5<(>x-"I3YcmaNATF j{C<9wt*HIR\*lDhzvU_?R+m'ֲ[ti V%)L' [w0ziSzS>Uθ-"Y(Z*Io'emurjjNI%hGO2Z[R>8V=iVT*B+(}vMw7^F>h;0]-7R:4kzL [xeFV!vUJM7h+!}RhSĪ U#/B5(jWn qrnr^։Uy**urK1 ڔix헂0vVu,+uI\R }8Dچ޵ddwȪd8!5)&Vƴ>8!(3DR6Pa~~6 xFL–5~*t&TTӨ21?;~aӬG*Xo"3ɄF\¶9[%-.}enBdgB;-Qg0w..]ED NL唚^Kqy!k=:8xZܱ4t(-u+ Cm\)O+3fpǕ&kWa$`LFopFypK4Wڒ9)0<*PfM 'r5 *%E-kBi_!^}fONs-mJzydБrGţyTyD@xڣ7F wgb'̗a+`xqm4p6LmxJwѴx~ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*GoTe6*ɩKN[e5Ո+FpYc;};˱%gߙ5dAO9=@Fp{ 6翛FI~5#ḓvJN6.4ӟk=K!H1ߊ?վw!L7{=r#ѭ~?R;Чţ,vV%P`)ڙxY$'U<&Tt sI 򷕮|b [5VKzg*';`Wx=җHy{oijY4W {=+J$$ԓҠS=maWf]vlUٱWf]vlU`bGGɯ/r6tp hS ,{eٟɝzϔnAv-o$:oϙ_"4#dB>ql>"4gc=:Ǥ8Д'1=GI~#cWBU$r}|6*S>/+ulb_N@=R}oc/qB?'p <>fz!kgEhS̼g\֤&jȞߘ:G冉u2\JjvP7f3{-l4h $y.$ܥuE74Q?v1|'մ-=ܚ4SA;53''rWZ5cT$d`i**i?U'xc o~缍[JZ].2k ^by0-1 )=A־͊?D>tW厛W Մ4kׯ?G77 hOhr#\r^e&OѷOOˏ]{~hSK:mo4^Jg&"uABz{?Wt+I5=IpD*đϹϕsƢ:m8K>_i; $˔cE??< $[8Y"(SԞy #ۜva՘*Cs3^d>Fufe Y }ng(d,#r/a@8||~~ey+wfcaIX"Kyhrq]a*M$G ^E|H;`⣾rob^8<"J2G?vj? ]NO/G~TC4:av۱'RҦsZ|EfO?K37gZH•(ӡv壿%!ٲ#;rG1}_\:n/ˎzO6"nnDԊ2?Int̋4!,> J=j3cv;OԏyFև1ro+lV>s ̒y?z_ { ./-aa.Du { .!X8CQJl*bߟZ}!=/섃|\WaCR@#HA:<;0>Ƚ@;?!=4zo~##Ar://ME9W=Lq Cԡ0 Ȣy ju=GLJcXCSWQJ3HnG;/$X<;Fmyk>ZkZ2YgoMѕ {Zg)L$3 R|753_͌x@j y~\ndXff \/az 3#0%،!<;>ںXȿY? 9t_$~_hWՠm'=W쏌3i_.1'qq|RUO-NVsK9V?UA窼#Z}Z"3Dč i2-1#~Cԧ4R]4 Ʉzmn+F?Ȃ[3VFP֯ b傊{jEu@ Zmy_ɧ]9=B^O3ɺQg,l>d$gFM~9J2ԂTmXyI@eI%.>^B Qҽ?[P!MpjŻtHg^C.7T ˠF$Sr ɊWۿlD\I%}pS$ZnZEUBRJ6y*|ylGIMOF=2ky+W.|^}n\ r?"ꣽ™hTVu۴q$O#W\Fs%"m@+|r9_jͦZ0MV6 ^qO4뷾T#|HE <1]+ȑ׊ASYz-r}Z=#+pTA3ɿ)k-v1nF;ScfC\&(w<6 col8MkWDeY{WcŠ"_LisU{XVPvGOI-﯌HY=X+|s$|y5|b"Դk8i\s,ʚCE;ؐ7!Ӓ[a-/a'֢3yHR; (ӰIb͊6*ثiB® 1WcWe)qKثv(1WcW"c v(v*p2@b rpS7a6y_F~&T/:|glIb| .S\ UအxxRثb:qAŭWSk?n$ л Z1Ixa!NT?K/'e3ASR.$(v0UPi.͊v`qK;)v /t4^&@ݚ!WUvlxeǛU%j$9Ҡt#;i1-P(A+rxw!n62IIAdy~[ -$K ᎓7Ek-(8ѧNm.o'+Ĝ'uwabYLvo_ Y$cw#U еYm ˬVO0ܟ4ep6=;%BYdž$By=HN>3Ԏ ,Ryvq"L|*MiZg0 +H$V<=*Q"qGVj0Ą C^%:`;/]̭2wۦmC'P>"ZLЀs`L6hבp Z} y!]=M;F$t@Kw"fiCe[JRf^v󽿖@9,ӌ ώ\yJKVj+Z/S;4O7K{'*We>]i1p,A0BGIn4WqUiH|(ЃLQ|Ǣsً+S˱#|}qMw` PZj{ >,QűOP8V[jTroso\ jiN]KAfL!oGVw"DPYe>'}ņ&R=OH#"!D饩g2˸a{DASӿ.%,-cNSVqp3*xT(% Wke]af G##)_a tX8{ROPS&Lh3~m~e返^Y?0*3wgjs}ٹ;C4paO6Q&R耴T%{|e~wQ|KI: ƒjN}+tY22/}Ӭ"mѥvlUٱWf]vlUٱWf]v}G~do+$a=V8 Ĉ[m#BǚxZ?9O/ݯ-Mߖو"2bLߢ}>,Qhgٳ'[iO0/ Qۻ/d~l~?X1M #bwIuPle?Y]ZUzOǗLsV[Ӥ U_¹:Tm?_Xx ?6 &.; \Vޜ;mFDB Op;[+e^O6GZ,TmvlUxWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*UٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v^*UٱWf]vlUٱWf]+vlUٱWf]_F˾[SE^I)j!ɐ $(ST 0TQROA_¯=/qEO28?05W2+ x$1ms''aKhY0DJڡW{~jO vhᵁFi*;r{f/e5>jD"uf<#B2>ێ&ϑbVR{쨣HQF:nW >2=#R;ˬyG{毖%lY؆%9T|>~6~_IRz?tݹa43d Ȁ rSj1R' }Ǵ8"$,@<3fQ~:=>__ǗGw<(KMգ HhZC[KVIO7O~*}O|ퟕsjS6i/3HՁ՛$KFz{e.AqX TI?ޙ\Hڜ'hv:>fKKW\ujmeXu yN0%B: xr/|+Z(F4Q ;ff-;ki51D=.0"{ =b#>=G@9jߝAĞKյsTl[ (j|d{ߠ6\^k@矢7P3WW߉c~~{Ŧmʱ6S7"og,O ר~t2al%;K׭)ោFf.]o>3b&F<ݽ>|i@~^/ĤD+M'Ⱥ-tZ6 OqC _oLߗ^nt!zVѳ19 ;0_B.+ŷ~}r4!˦vw-#mYMnN>bؽVkҢԄG_u?ځxr1fysP%^5JriJ3ߠ6*:{^}y l&ӭ8;{1+9|fcstO0^CzWlsn憣?0DϺ'F='$Γ 1LGo/_Tj#mQ'w Q~M3^Լ;iqHf.r>tyUs[="R7>OhP0>/6&]'򻹑av!;ԏo ~AuS8,7R+fFpc$xKؿ0Ń}A+|տybz^"̩j{_mV,-;%r>+@O'YWKkhӔAT@*@kg2"Knk XqfrBEh7ؚT$q%{X̙LݽϚvZE Mpԥ7$VEo**U-ZyYKk\M5UP3@sK|(ȓY_D֪ A!b7$:곲i~ePvR+dXOnGD?43#V*&["<^ԣ{m*iGAWl"55F2!0ou{s!q)R9 CP[i4x&S* RO%ݭ|N$'hz.*T[bv;&ZByl6w4+$Kj IVh*,l#HB+WRL =(rT+JwdoXUzb$(NU]JH7N==鍛I2Baia=*#RrOۃO 2+(xI??IUL:Tׯ{{S_= EbE=W‹hE 2@ZgU[2Uy gcޝ}~wur hS> 'C o0ڙ#ynn牾"YlnY nD~]YkpO98WP @޸#YPHYrP{u}LcʭEM8uuml[сJҹih֫r-I*~>q>ԆX +oYHWhVv; [XZ܅}H 2V`G7i`5Q]6 "_p(N1PkE7bRĒ]ѿjݐVs A96)^E68PUٱWf]vlUnWbxU`͊ v9vv+v8aWbစv.A]]K@ز)v*p$;"-ط^ ONәKSVEK\*n)vX4WeȡxUxٱWf]:CX?z)0Qj&g=W^NɠœW9&.yC3ኻ'+;6*ثb Rv(v8Rx8K@qWbqKPqWbbKHQc"gOCDQ ͊6*ثbŔ#]®v?vX4wWbNP~v9M69ئ;lU* vX$~Z Ҽe5H{ܐ0M$^h|h/!AR8ZR}zJp;˃en*ayX{7""r!972Z$F8ȃg)xΣt]gUt cuWUOG\å|9UyƝ!~Mj{=i~mTETQ3U|Y9i:TGT5:ÞGI?~?s$dDǡŽN~э>Y{)A|2\VVL crC{04ٮ#E6E _7\u CoᖏeE. F#T,O:Ku3 ;}>8ۘZ 4B~SiV&9rDH!Yфxj;oO~?=|XV~?S܏_?N>z^}iWYoz0",Cyvw!#-s] ޓK#b}9")О9c(W{11MoQ?>g:gvlUٱWf]6*UٱWf]vz{pi&6|==2Ke|L-tkG˘uQ_.Td>Gprk?,eE\KuO?_k}ij;;/է˓cCȾۥ3A@ͤZXٔ;yR~^/;yZ`<'y^Oi* Fʟlzuϲ:G,yH  nbK.21Lb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊+v^*ثb͊6*ثb͊6*ثb͊6*ثbV6:Znu;qEwv4 nI=C&AHz$ -f @'?J?_4^ ?8U4sl[ K|網팇Xbaqh _QIO06!4C|O}&nщ=zg/hȖi7wB+d1@NНgIŜFDy`XQx_l' cfaSy͐楧yOOLK 8^V¤ /@Q5~>hF˺ sHA ufow$l >ٸ'HBRܝ !K o_yqlqus-xj74$bB$n?)+<8s o:Y#ʪ8ǀvU;q ׷3vn$`HNQCq8r'h8|Y~y<Ay~uM(g\B &׵f^(Otp*g6|ϯ%[;N\WjPjU/{3C :9^ǔ##FDZtsw~:U? 4.g3j^bԤ滭N?5 ƩiHE,DiZ"׫3rQo)oD0B/?d5oh6s'/}q|&뽝U `/ksc??wy1\%ۡxWSMn>'I 4,J7'U5ƣ=?T[EZ"OC@Ɓw!yPZS/g cb&R5_ˆ:f#7\y4,y&IQO5֥lA]^(>![Q$KEx&R2w'x,-`tKxAEHUAk-2hH"?u'ac=D@^ޥ^a4'E~,7؟baذrԳHnu4>]zDbik3yf]vlUٱWf]vlUٱWf]vlUٱWf]/vlUٱWf]vlUٱWf]vlUٱWgogl.}j0]%l0tw~`„n/S`8hZ5*թʆœ ѻC)SB2^HJfSŎǿEߒѽ/'yJr9G]#θ6E3j|+T)" VA "0;UqXnN+ " {elh+j_֛"WBUXt;?j]8Z?D?gu/˯+ >TrV٣n>y Pm{̷>8-,I}x.|L~lmc[Ia].h+Xܓ>]# xd]ƹ e m¿o禮+-3'WOR!g?.ǮF/&S Y&ޡ4inHjqL߼V#~#v/׶ /?;4,D֮-pM;6_F mWVʘ"N r1u~"%h93GG$ !Z58^'*TS8]z~5˰Iʿ2fsg/Œǭq[$RF/5-HIu u؟' vN^mAQG"͸݅Q7,M#q&ND(v!Ϻf&SM5DzI/%Z9bЊWa[{r1ZNb0?'UJ!2+ҽSƨ@=H\T3\gA@[r蠰m ~*W#kG;qVzG=FRew ([bGN}vk.DTPp[VW=(Eq%VzK(Z%{;K^†(2*C%u/U)`{2)!S' yVթrZF } =Q.C:kX6lj qt h_R:6q@= pbRM*NJ>}ۨP$eޟ,$m*fhK}> ƞ4FtȱSG]f>g|"Җ|,n׶xt;wiV#}1K电dApVM|N;Q4oWq$$@&T>{jK{"4WRkg8[Q=md (fʎN\3GI}w9YGkLTE\W&aT{>}Bjz9_0%x.kycq^PxuWXx3DnOPrrsyR{=c"ʼ;}MЏǕm ($nD[ĩ_sA;rDDy>o?u)o R%,*;NOȹ4&!I-%I-$ P~"|p9.C¥h@GE=m;yVf5d=3m&S#Rw nay㳊eP޻U윯Xyzi8 7J֦{ ;-;Rk}FV5:9ʽ(OsI|u9e(6aHy+FF.e@59h4b24vE<";`Z_w3a #P슒22fk $?,HC;TA 9m.*V9OAE dVow94[g<&a@9TϨ&)QtHI.%n^7zG|]U`Wx/ 2vImrKwUFŷfƒT퇚z$T2 Y]GDi)@I4pB V2&+It+5h4>ҝ1ҩ`T֣ .eeduɂ3eXSţR`=%RZOTlVAZi`gh+|[r$ZU=D%CЭ)_Ǐ/u Dv?MI=k%6@ |4 ^`y!W?obJvn4t M> P2#|,^,|٪iHH ` FcC|S)(?}XV#vChz,⿺_A~҃綸.cQNDM%څH+ڀb?{kU=lo)|YӜHX5T 842F(z&he,2s `yS2)S[9E ].{dbAO5&z)aNa5@r.&)h9~#va[O&ipҢ :/ CÑjɂ3/_w {YEWۜ,;l8giqypװ4d0w̨prhH_^Ho o:m%zIg<kO5SN3!ZCe@po/3g]z ȿS#XWf]vlUٱWf]vlUٱWg۟woCr3H~*AD_˞ljs #WN^oz62\u<5y;|tGI|FBhނtkSڅUw#MH1i9%:xO1bR{{G//~,˚jmG~sMjs=̏4JŞIff;I$IG8pBccb(>Q);4EB TP i_X^me`-RQ*G!9?oAk5Q"`ӛw.0Aog?7ĘÙK͚>n%GU^z $~E{ȃԐ: ??QQ|(Vm$>5?eGO?evey[D'saJ}!='fw|3EaMVq=pI9MnX8#@~9vB"-DHi&z(f'eUs2k?~_TlwWSL\;O8G}G)J@ Lxx_ox h?+_e_y}+| ֐[Ϩ\"FPm_sS`ZIu8г3# @7e,D=sHF$IBpg67;jyo?&{3dF(b'&9>8id۹/8|uny|c>`7wMMl?u-~(@?s.7 C_Ygc0TyI]|4ֿ7o+LA)Uoh5nsOlhʀʉܬ˔cr;δzIj!}+_5gqmUo$Ҷ@$*ՏLE&.ȏ*eCsݝ =*~E~v}jc78?Ȏc)rvqi0v_Gp?~{v?sI4>MX?QyLze,VVQ$IZS>ϻ(?1X= }+T^trkzvkHJ a 臍#.l;)jxl-ci'h`8Bh̕$e6-5Z4O~o93?G:ZDoSO^A׏OAF{ d{C>ݣ9 ~>\M&1<>x瞆flUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWgj{[IqyȮ)O_2 |G ɚAi!4 Ϧ~tB5g7{osE:6qe$FK";u2AHR:$EGJ cBcõj|N0EL6FjNjq=o GEbld5L_cheb%(d 9BcUZ{᥻4Ȋ)Ő)ajlr]*x'J[ZQ$=|04'aNu9pQA#6)!#eLCu8,"R≐2H8ZC)8}NvYeƞ? &X- ˆK LlQ򷦆Nv;aQ5%\s+cO|L@cH+ JWM =YȬu=鑪R!o,m M"Nu :8gߖ^sCMzgR,/F;_d@ephU|ҁ<*ScN_#”h#!Z}j|O\9XE+,BT)-NI8ASCN-c22HGz\Ajs '$*!P<2Z^KHwu8a7ʵ SLrK`j_ ׭2(;x X,O$(uwpRQ׆A'-(qsBzW$MKOͽģ M&d*m,y2M7X$H^9]2G20{䄕OAŔq]X\$*RE Z_|5젺C*c Ev 8A<ީm^ھ}qo "$/J'XK+ar펞n4=rmn]vlUٱWc倅v+]]AWcBCx5‡aރOi~[)c֕4=$(`:fu˘mGzl&h]>˯yX{w<';/ͭ;Mʫ&5Jep+xomjycqiQ5) FFˮD3)h(䌢.xpqJֵ*+^d,+L!V|tQ)N4 wwE[?W$juȒI&)bYSXپBWzuJ亊=MSOzT0NLjkA^W$O0EP&fD5&8TB=z,+P\ȥ ?c, %prQ%eSshLZW,ՐBrhl}cNۗ=(Y {kUVmN#qC[O-ѸKJ0w8)4ڡA W1`Ejo|h"֦+@:|zt)õ=$w nLpTPJ tU j|LD,'jfV>TE'8S >钵gC^nmIʤJ)]yKj/zvˏ(E'n4ڔ2/ 0??o-W QVo$ae~+œcvI Cpɽ;7_h LJ9G2ȎH?ȲyBy'Xs_>VMG9 [>ҏ2!#Dӳ/?/ue絣48gGGYwN.dz_Cc^dƕ Id~lx>$X5 (l3&R6Nhx1rYI5$4?#|y5bpVKӅ+݈4&oo~vVn֟N1Բ;cN[D\Ϧ$A gJF=6'*6?O?ߗ?O N/KMӡ%iF;GWv%6ma9S]., q{6_bic1Ð_ᗷwa43t?+_oCЙWb4ڊj;+h.R5I Q2=ٽil*i埒ίͽg:?$f(B #+Qv5=}(yOiiiF'9^mZQXWf]vlUٱWeb]vlUٱWf]|ӿ|S޽g.EUV}@v< q)h);5ûw`qtiٝo~/n|oӝf TVRcs?=E]5Gwc?c|gя.|Uxb͊+vlUٱWf]v^*UٱWf]v^*ثb]+v^*UٱWf]vlUxWf]+v^*UxWe]6*ثb]+v^*ثbʦ*ثb]vV*UXWf\UGpp9tu x:.2F 3T4=>ޙ?AiܲLuI=fu~^o2=8?}UZi,j f&5 HB@ 'ܼW s[O縸Gh933T#99zwWsrV˨RUHv_ݩsU)_vGR{q?+$:Kc>~{_#^eywA7\<\UMS0>l(8O_UլeԂrYN:e YVH1WVP:\wV4=O`kGH5=$UjiJ$c|1|U 3GZOMcO5/IoHWoN(%ơP ,2$;{rUZn vvC (8EUTA?娄ڝ„]-ݙeUVf>T%ku'0L3xS)J1d<ﴸeyş?:7?. ]T|zdqƈ<2aRgPF;:JOƴySu:-j><~6 EG#v8/iJubUS8;gj<Mhgo6zʪڝrG(2c#O1>n|+n2M+Oa@g]X;/4xBIO2l3.Ye%$蟗:qHzG?s!WԵ%t> uڏލ;MJN^F gGk^-Fsryܾ8BG埑`y7y[w>(2A inq;T3$?'--Jg~p\MIWp*BIU:{wT~Ϡ4 V^R=#Lw k3(PwRIc>mP*+:_l>"-Q|WR#Rmq]S 88%uIF!P>?lFJCZZ#M0 .f3szJ6HLg`s\{ړO q!5=>X" QOo/o3jݱVX#f$ģjCZaB20F pRp%&o9 dZW劗f;EPU xhyUY PȬ/+kOL5rn6$W -DJn~}6MSm# Ԓz;ൺVPΜx)r+_2ess_[izb%٥'Jso妉u.>'(1'1;\c+ߛeg w8eW`VY 8|dKj1.&QC풋_,8J 5YHտ7b-we{ >\dݔW(9YS?49XC $ `z帉~e4Fw1d#ְ᷃VJ7ÛYLGqZXh5KROaIoxiX`;#q"?^PIrZ8%8Jا٢7T;rJǐO iAU%UeZ`2 I5ժnhU@i㍌zAv錶Bˈ!Dj=UE)Fj&kず=zmLڦq.UĦ!v#*i:A쁕4!G$;afQV7+ONՓE>`wE1CTchVXexG'I ٥Juèizv;'Ԓ3U# W AKN6{x`^1U,t7,9( %sZc۶^ Ϥ}n2Hb]O{HFSֵ\zYC+v WY,# %,*zʕ=b=H܅ 3D/4f0!ץ2`]f%IUCF«gՌ=(QTݭ[/u{M^F3q/tTb__hi-dC=$gg͞[{2z=^P=y}>.y|R>Nd(.]$3M mJpUƹY hSFW}8xIM+ªA{bLثbΧ5A/5]&VG K!7 jk1vN gh=-0 PM z?Y_zwt˟&#@e{ ( #_/kj%wvu/=)h931eٙSQ .&L".SF w&A&R4䡢u Y؀N~n+$o"< ^&ѶM ~K@OT߉f~vX*5KS;q@e=c佷Ǵ2_~c 4{~w-4fc@䓞);ޛ5o>e/[CⵃGl<Rj#Sԟm>4rYrH>d~Ks#>RрDH_v۞؝¬v>_,bs7v; ?'?ߓcA1? ٪{_e{r|33ç\vėyKЅ^~Qר_ϗ9.f]vlUٱWf]vlUٱWf]vlUٱWf]rcEե[_- T P2á-NcLwξv=(ٌzt1@g^X󦋪y;XZvLʅ ཁ۹ [0` ?҄>Fl0"+L6 q?+jCz.糝|$5=6>=îӛǛ2G$D񣿛300H?ҶIq""+kV΃O-|yܚZ˅+Q?٧%?<}}WfNx?9Dr2|29Z-O [CBM][{ wv$dY#u5 *>g L"Q$y |}!alIV#b2 1<R{Z x Jfoe뎋Q d Hk)ͤܯT`~rFy_Gseq-CFH>gZ|<ȀGO}A2,`p.bvlU٩6*]vlUٱWf]vlUٱWf]vlUٱWf]vo*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثWeb͊6*ثb͊>ϻ s[z~lY,']CwFA_mΌ!#Gs'ˠ`jl[i~ȕQQG3" zGM4vìqF܀TNOˈ/+>'xڣ4_q )88/Y8c{C۾W񾁡ry⬐~Bv,)PpޚwL>&Eaqqq-ܯut,ұww%I$I;s(∄ggo[ŧ$"Q(DDAEUQ@@gOňN1 AgQЎK;Do?d~|i- o^irJ'IF,q;dGe_~P^OZy}Oʺ_4iq-iNĴ1_c\?1ty_F}\uo*yI@Nk6Vwz͵ְU"en Mɑ;`gwct{iUYY0!A#>am_BuϝG"|OxE?&>帴,&6ڞVM %N0roCTM"FJw_*?[Lp6D%w3 [m2{k!~MkTVc0iJVyDy\r]_#e-l9~OFZKO1&h졡}w׌QJ?x@+g7ʾV:, I$jUPQ@WW-VDw7$\z@zM=ѳثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث%|#-R!-Nh.`q s3߅?>IEeΕ9!zdϸ0FGۡC˓ơ䫫|fH`>5uIc bUM#-@X(,AZ[eSFZr2R&MJGQ/@N V?,xc^!-42V X0jg 4̐P»vdRvH|[o5BIE&/<5G0'RFҪSSS3NǮNC%t<ѥ3G9}zg&o?3tYt!MqQj~`C1j˄d^e9y#]e@e=I;uF|h?,H~1ЎABmk|=[du1Ċ 逥*(O\(« RW3xDJ<|0D .AiGmVJ 8LқQ\*IbևN#™:RS?$%w~ AWjヅqo+ qE:ɍ(FLmU.n.4E<~N[a@zn rq-isc,u(ʤl\>XY#:TPҙOv^NҮV4onk[* oȘmYtiC:ZFxLx” u^}}<+k#.H("Bjf['$ )ΝqtlG4`HjRG"88ߐt0oE|\sTZRxcR{,P6`{~M퉧&4pRG:@(2ܲMȍn9cXă$XVim@WC1$! لH)7-a62(V[\)5i+k*tizFw xcRL&ؐ?)jWU. #4`@fbUef ,׭u彚k˖x?;'&mܯ烅/˘{Ttv{߮qȿngZlqҭ@Oz_&299W\i[\2=џ??4qx[HBN~fN=XWX|v_泺BAd*v̱ y8r΋bMKC@ L~X3EgO8AVgc@')˞824䨍o",Ɗ7$kp[q~qʋk]j$QLC,ۿibu=dCvvgx5է?њ(>9y䝋χgZA>jj17ws(Xo3Y?}HV4! 3yeXb5$9yxϤ}Gǻ>z?vT՟13g}8:GWh4b~ԡ E~/v|Q<~]BO_dx=1|,#cl{ =gg}sr? |oBkA_ۓ> wX{g/.Q.b>vecB+q4Gss=4\7 ^YbjI=9b"(<{bxUUٱWe͊6*ثVVWe͊6*ثzZլ|`̗70hp‡58xKH264bdhӟ!~Z<{}Z B ,6,g\L~ݞ$:qlƟu$ms56ω_T~s(>nS_Mωs-8{?!,~[Ɉ\c8hcF|1؝F|ϯ]f]X]鰝&zgJ~ku*}:\9|H꾻hpve2Es/-\%(I~_ߖ#Uǧ늚'Oz85ԟ8Ovt6a?_c)Tޞƭ~xO;\sb͊6*ثb͊6*ثb͊6*Uxb͊6*ثb͊6*Uxb͊6*ثWevlUٱWf]/vlUٱWf]vV*ثWf]vlUٱWf]/vlUٱWf]vlUٱWebϧ_?W_7PF<8j2!#GߵGsaq쨝6R7?`pwgǎ\_1 @~lx:$X% (@3Be#dI^ <,ƤI*_xʕ]ơ`TwD[ڣt2^5ʡYw f/lTO0?Q=5GQOC..q-_6ڇwt/=KM+Q[mͻtdYm_٧U,k`Fi5gv5$?c4:ZQ"G  Tfx/-ykKng_+ZEci%+#@'rw59/ÿŖߘ~Ya-2,(mXc]a?|\Ho99FMI~Yꫦ\YڙUMAA $!O0[UeS.P~ZbCqS`hЫo޷|>LdGmvd@H}=c:?O ??y/Konlj\?\zi_}Ni_>[ mXꗿ}q@8ӌK͜埪Y}wk7RFnlU!>*L=[>(.ژbBf ]#LM;Ɇ1$xaF?%$STʒm2OT\?xXN%odH9 @U46Aab #}ykAש'ј*|~cژh,t*@Ô*&{⁃0Jx*C\, w-!E1ޥ|U mawِʼ '|8"ݒFIT\NRODtH;`IJ\*LSxLcc^a6 {8c22,$O. k18Zυ@P*T @7S ,T%zbWE+1xmP2 SJ<,{ԉAkRA {X0%uh-yk@5jb@`zҗB/,J6ߒ bFBj= թ; Q*@vE&J$' WⳕGned,8@Tt:dޠHYAMd+&-6_Wx~y #&|5S: Edv7 IBGF}!q;sC74ƭ-h.08ΠTc#¶4ܐ@:h0QCXH^ u?3FJ{ኘe#F~;ԟa$Vu;T=ĭT^IӅ6xlk߾$@A nFvR?dRin[,56kuo jӜևrq~ ^$3JT|d u>=&6P6R74=}9 9#MQ? ߉F*[4O$SlS oJNO j_GR0w~1%Nud(?g~橀+52# (mC"h+IbmS;_1 U{QlǰZcoqG$\wB]bJr8I| -EzbeDnC=">$QB.彰]Eݫ%, D\ۅSB궚nmSPM>y([:ˢmLO̪{煿83ɍk;dUف*S v^N͊)v;6)v^)vb+].Wb| Uy;/ / /G7b"v,y!]*f*i]͊6*UXV^V*lUxb͊,bc*x]v(].®b T˛snOC䁶S>;6*ثbvzwqWߛGfRש1V2r%~A''_(d}o -CZ~]sⷓԴIrvY%cF_OO1yΩE&oJ=j$힡F]=SOl9Q%/2A<_ɅlY)4glѽ\ zz$a #ze#%^kn<FA';Z)Zf!2BJl0 YVTe zPDz`J@]n4Bw`|9 n!F HFQ@A)Ԍmю!ĩ0 lj{|HLt-Ƭ.9OB '*v4FJR ;МI*OJ+AZu 0O*c+" ʄd< s ^/Pk8;zp"%&-vdYV1wǻW#D`W7{o ,Iph S {[U4&F8I'oHLlI jW}kTADŽ[dZo/tYf&J8C'`AHxd鶟>pYJ΅ƛvOK'j}фM=3jU&9涌cxSat?[]$1֤9iKWmђOKҿ㮱"QKͭBByZ3lFK pɩj2224Q@,$o\Harj?/-f *Ѡ_ͯ4+"QB8YF$.O4 OO͟5 zR+ݿ,YV+kE$Ǚ

    V{cj~bUI8EZ<$?󅟗7’?Q 3 _ c#/Z7iZoՀ?.:/\XӍh*:}X9+aY ytNY6,RGZWB6J)w_>|2I%ű? IA!?34K 2hgxX8/E7mZЯ5ѓ;O0ZDð :f$tIx^Myu+:9sAV֞Cͬl,nOU׮ [sq`x Jt):|h ۑቖY @?%D)PFj|!J"Rѹh쏉$Caԟ'eȃin9ehî /QSယEPvKTx("EMPx9-] i,I07Cl7ki ,Uwz\QguT,P"۹hQl=2^K,?^nGф$V--t$׋7ZrZQ-+%v~8ݡ*QAM3tI^V? >vlڤjH)R-d@[znAçb=[Qf+xGSt*'yAU2uڟ T:zs"b{Kcy(붶~Y$#l:/Oe y&HƒWy^b'_# q?L7k-5>ZzJZ~'u?,յ8fst!>NZt ooUIjvbXs?hu^rfysLr=dz1m}(a&G%/?%秜u/o57M쟺RWhJUߩϮ{N:|\7=dzxFsFEnnQOs6ثb͊6*ثb͊o6*ثbf[Z[͊?Eg-ϓ. \^>HG8zϝ?h PvF^,|=㟘^кEcS:/uWq 8ZMEua!y?j!kG0yN(\jt>s# >H>~ cOO??{sbϮ?NߕOjAp~dN~vz{ŏEPI!gLV>{J:ygȯw|~bƴp>N_hxzr~y\Dߑ\KjNμ>y]+v^*UٱWf]vlUٱWf]vlUٱWf]vlUxWf]vlUٱWfZ͊vlUٱVb]v^*ثWe]vlUثyWeZ͊6*lUٱWe]vlUٱWf]v}2ϛ|zdnT=ܣB3;~ns}=žY ?@v}͞Cbc)ACroGX/Xhv}I/4UQ|͛4dMy^1E$+$%I=S*J?=֥W ñ*,O R~| 1 o;bc>-WS[ZJ@Hr~pX\1id2\]PĥݍI}_@!)H̒vwbdhn_as]Nc(U݈UP7$ 7G%_)/U3v kMF}&H$qDرyY,GB/4y[j<ͫNi ;WqVE$%Ս<.>sވk;U t*'gϟ;<?!|e-+$UK Mk=*}byoMaȓ2Yr*@˟&# /Lv3Q4 ^n #o͞f'k9E=n-Նa kSQYmvsFTS_ Ͽ%'4_ɏ/yg@)y!wsNNMυhg*K>Y |" GcϜ;fvggGG?O-tWߞy'c6gtݎ ա5gC^37f>(Ɗvϒ??S#kMBFtOUijnTF.K˸ut?>Suʎ癵t((E;c 5yȘwy@z2ZO=e3FZeR sTakU+Ndrf4`ȋ٘0$ߗLj~=qޥö Cơyk )eJDiOՌ1~J RFbh 12!, ̉ k GE SNR S LZ_u_|ŠK%hE+OQ1Pmwe-u2ҴLNr#R!Ve@„xa)j@ryBnlu~xЭj3AH8ЍTP+,5I1"'OvWVG`*FmirM勘58ْH[m+g'r 6!U#!5;tuۭryֿd!Ǻzׄ Z斁Hj,݃>Vpt+U&i3i5y#S j̱xrt?'?+"X-c+Hy}$u>eP_NZxTS(+\>YTYVJ6֓3@}0<JYۿ+/*ZƤթ#_;0#:ux<1ܐީ8Qrv|HZN×k3)[r} qͮ:Lp% 7ӏ@v&/NLPphB6ӂƘ/'TK)?6PJXчSZd?,?,PLjNͭ'cC O k=F[1 < sTzb9^gXn6\Ɇ[pr}~Iew2m UEԣtXFϟISeα5XyWc.nذbbኻQQ.co >6 K0\-eۯӲ$pG A6xۦv( r$+`CbeKb)v^v^)v^*0Rr>Xخv^*켊]u/G.N!,϶"pXUiZ[Z͊͊6*ثbf[͊]5o6*lUإ񊵎xኵ8PWbbqWbbCweO ' vF䍢b`-nb͊&L?0o @*֕c MJ{'<>A:ǜ/ఴZVlӍn.b/M?g5~b>ӥ~Y8 ?<:4m< O1ʵZi~=j XVTTAss-/Xtd,jw -VOO 6_/|Z'l nxLi3M%Bʲl)JmASHo&tȮfNTZw9P *i #ޝa] îZ ]6Aw+R:*sR/-!F j{Y$.Vfe"&"=0NY~ :0 45]߮ %d*C^$,YXG,Fi$|'X 0t@$5*}C= ;1dm֕K `'T(;Wȑ:\*:70ڜpW`*wɈYE&_Ncb#nwt^C,m>Uӧv];:浌Nށ2/ᆻu GQIԉM>C!ߛ7W?B&0˿z.ޯv0)AyV%>Ƚh`ї{6,E$d^R=Ĭm=kOд5H4Dxi"UhRĚu' m54#UZ 羆;$ӥwKi͞urIV#GnңmAƽĞH|;cHLzM[I2\j2s$ Ԧ4[Zh2;qJ .gMqza#vOim-yHh7#ƸSzAi6)IEb%I=2[*Ǧ(x]z᭺^ȨI4m9e1m7Dt|P %w*Na]q*р;;2 -VAìͽTyD ѱ#ⵂI ㉽gW {S|PR'h> ZQGúW(EwoŁd#ZKB6e\wUasC8*I!fI/B@Z[$gGلѫxn0[լhlu BC {SW`VQN-.dh@~8S_1k9߫Gd l%9Hё8{ʭ{v)B[/^=3__^rӄʥ3``^ܼz|p[ZI`|vb^v5zj42~Ukz>V2Ju/VF(F탁 C/V(d ǽǨÑ A*ؘPGVsG$~),Z@ E j|I#`HxĬY @D#ƀ #]!6ꈲP*J 9f;TnX"mؚw#lT(Tx+փxdVeaރw m dv8=+UB9&?kD5u%ݫSH@\Rm6P4FƛSg<ʹ$cCnkP̈́軌2!YyYkB8MR?ԟdYľM:Wjx.GS;Cs&U=9#a@+@|2G_+C=/*I#ھqr0@OSZ/oPQC㞴֎,Z:ÖN1pB A'? (+|l}=>C9۲=O/:('^.Z17)c :H~.#?."%FO˩UO^T.'՝ԟ;6~vbiKENjD!czl$KyK4l{Tk 4v[ccqæy:;-AժէZ=>T?rр_f914.h7!CI>]4GyaNrY uX?3ϟA~d?o*\Z1/NϣcQ˾0smRIњ#rdz{{Kn>(dqW ⺭93$WK{wq7:d7:VNzOqUזu韅ӮhIodfWc'-(S[ϏN|Zc=vK4}a<@U_maQ9!w嗙|:3=̈́ h4*~@ {5';UcfV~A{yԤVShAgQ'gTt87vlUثyWfZ͊k6*lUٱWf]vlUٱWf]vlUٱWf]k6*lUٱWf]k6*lUٱWf.͊͊6*lUٱVb]vlUإءٱVb͊6*lUثyVbZ͊v{q q3ZI,1Wc#{]p<#OG莢^CH5r=*l?'待e%GeD"6Yvc;˚~]vYfx#d:=v~rIH$ t1  |?K冽ГXr2>`77}+rKϞV!Ξ_J iEízgxwlUpE`$6x-{Dۋ0c+T3* 5~F?hWdǦLx!rLr5Hi~,Xcs/~qWZ{siztޞ|}(X,f3qƜ?/P~qu_2hm- Ea <ZWz9Ob&:L3<\xxG]mNW ÿgCɷpyh|ǩϯjHXOt .cUP Đ?Sg掉bx'!Ero}s5yW l'.xƒ5%u_ӡiT(; Q >L>f9K!"O)?.ca /Eύvct<䓽{g?V s/Ap' KQ,Fu?ONo5D~O=!ϩzw' }|yynYbjI''=1m(1,(o6*ثb͊6*ثb͊;6*lUثYWf]o6*lUٱKbb͊o6*ثb͊v}4ǜ4=n(DƜ5 һ9Fh,4:!eug+m㽀?s"_`r@ ~};|e/0{R׹?4>ܚP ~e!̚b5$wlAH PΩ"܏ȳcVE2hHp\PW(dS3Pv%p: ԉ f2jOo|^'uFC VhS*@'1-@:g<|cYkƋgr/?.%/8O̧H){g9[ng`I?dȗSVBzt%UyOBۆZ/f"R@a֞`$l1(lnXA1 3[ODsCV#z7z xF7 p'pZ=JtV.'1ewD4aV7֡riF/ʛMUxk\kIT$D?[76椿>DbRM۹7m^X[[h\-j|I͆/8[97 [TYVKSģP{ @Iɳ[ǵh1tTۡa+HK`Ń ?Bk(}P@>"A|#hmtۤ5$+rtfƞIB}+pkVW`sT*+YRUa%lX׆M.*P#/ln`@&2Cwx_[Lա>7EX(~Pq#*`mVٹYT IO)hz~Xݫ~DodϚݙ^S "q_HMq{/ cEZ3Fr>zΙy4gUX LQ\ ?>t 2eȠ2aǛm '=վm0lCFoռir}R h _MpdwT~1ۏ/L$`S|QovE(Ok`'0E b2]Z68M; M JU ң, 58X0#yDf"]\%윰MS}P:QM}{`ZEP*PU4I $Uyɫ֘]qa8U:(^A$4N q[ ¤ea'6Ȼ),FOq-V"X|ʡ%I=2vC}aTreWSO1@soF^L2yN{0,PkYLRaM5{}nfQa/$;)l_8#[MWE-\YN^:W;]7 7gsE-2aSEnbRJFՠ/0ySTΗ[I 3^]5ܕddm؊(v?0‡b B/v8ثPإxv( p%xK𫱤bebbݎv?,`!]:#qY2v\RƜ 4Wc1Vbb͊k6*إٱCb͊6)o6(vlR͊]v;v< o*()o*()v(oS`ko]y/=DaRO kJen&?6h̷W>Q]FȭӑBy\:9Os|9KʘZ)FUꖎc+V+>SE"ה2=[QJٛ.R]1 /-_g_4yۑ[k(>CeGyӔqQT1i4vVV*洠P`ѧBb9dx }^!@M)D WZY 84viƝŚxj&ޤKPL $CǾMSU?_D#m-fc?f|h6ڙm,rw8j% 1q3U#vs%Lold+SAS;%T )**klj KhJ w:$fT [Ri&jTcȟphUEM)(L gf^J!4capau4@UOcٮk"Cz?V C&1V1ϐUs]cfYO 8cI}Q:~]Uֵu}Z٤]@~]o+=-^5K)#WE)f($zOOU@+~l ChVJǝ7$֧Bd,H]EݭF+]quV|d/s @M7'q\|EEkqZRSt<*(YFi9I֣t-_LROJ MM|p0=Dʛ|H 5I) n( %ikb;ҁ\82$ KY'Qy#w*%R ">BԄSn PupS,|wf7.*n\ !;2a'ֿ>`/'js>KiDlq*N'"e"fbVy2i 7] 9@h wrQB9\F  ߖZ|BP;rǛ,r $}TUe? _E39[&,^2 pJI$ anj[^]Lq,Q<.a*E v4 9QiUb*h$qJ, & BչU.G1U bPP{5p=R?VgziRX:Vټ|͒sZ !1Ͷ9.^ʾsm#YU^=3Њa勝99]AJH3?zg)̲T$scn*^ )u[)v7ӑ!rVU[xQٍ~>1 f&hti6kYkĐǠ8h6[:S " `C;v5ƫq.vhoG cJbщMlw96>bYyOPP1Zߙmg5$@C8U7MH)-ߜ{l)L䱒/_Q+W%Ec &۲Pn9raѿ1tq4dڥyP9Lx_qsH[4hwqx+rQxo|N9:O r FhoObp9IheUvHec'ĩꡟU ڧ\Aen~q钤H_R%$3ܜzN@%q҅ƚ%u<§zcӾ/Ȓ=;ml_MurD1[--:۰%sO=;?Sɞ8qѿ-n4qP'=/O-h >z9wv?_ -";hT( Hq77#2e9%Nnn]q,^G7$_:20JiVKe"[7>Oݝ=KY8CiCMy d)T8t-yH{ל<&"tW_6q<0poyd߶z lJ]#whYWIG"5os\ܵ+Ėf$I$=qDG6)vlPlUٱWf]k6*إثYCyKbf͊[͊͊$LE53:Ayo'$ëqmUX1#Ȋ,:)\B=Tc/+yZ6+V+ #(aC|yKM9b8H|M=']7֗OnrV >-?-þz1죥Nm0rO-?>)^}z<ѨQ:IG) "jX{&?-Qo73wg8vAt e1GpyEv9hy} ]KOI\*ʮ>G>ePÚq(,'RگN/x6i;#>]G66SKƙ2YҲ[-; WDZu! gb/ݛfcV luuvlUٱKbbZ͊6*ثyKY͊5vlUثYVb͊o6)k6(o6*jbbbbbbb͊k6)vlPثbf f]k6*ثbZ͊6)o6*lPlUٱV>b26%W&Zo=H߲Isڌ={#\%CR:Z<>LETUyw_V~@-sId?jI>Ynڙ|~@t=v1j]BfnNp<!y[{Lza-{[E\ {;{g4U45ogi=j4ׁ@oSc:^,B1qM/@Sv^gnvq?ʛO&>Tya`(xjw ,z}&@t; $#W䗗/˨ Ϛ_f~9>{{ZԏGT?#'U:pǟ*yg/.]zd ]O}4<;I$1fvcRNp`zPE`|vlPlRlPlRءٱKYCb]vlUٱVb-f͊;6*lRlUٱCyWf-f[͊xOտ5d̞jiX b8s=1+e3|99a~Q6PGAdF0xTI>5/\݇Trg>[i5{ꕪ-()'^Iv6NOJ"=MX̹B;~hqy#SԼrC4ʋEPK`8j% fH[[,S)zW' Њ| t'q$Iot@;bYV% y2-%>^R\4F._ӯ"R=6YЏqJ_P+d@܅}?,9? E/p.3! A mص1h<@Ok2lɎ.iZ^5;h5v ,H"oDijEhZA [>9C0m5k B6k+[prf [qj6RԺ\Q0[+Y,3Jyu9q=cj2[5>۔ EI~$`Qpqn.hkFXdP@3; P8 H,1R86?NV{&P5+Ru-Xν]\t&.-iɖٖ55#BF@/o_Ky'pKG% }3ߙ:V^S65r|8yn_٥Ïb@t{ U.Z[(rFde؁٧@ͽw}Cj4_ Hlxw#mWJEǩ|Kni; b?)0q*U\ Np2G+6퇊 ~chmsen"MX?4';hw./pX0?a8 /!'ڕ’>ǵ;/|S)u9dӮHsAh+&s>t~~\fi?*tic ;A:MXPMǧ+AS#`1Uت|;!.k2)v**Uv—`"O|)p0lvF;]:jXv;*v*iCL/v<‡fĥxif]]]"ٱKUjUUအ P?QAw/߼i[eb͊51Wf]vlUث_<ءٱKb͊vlRثbf. *p[<UTR()v*1WbWbѫH8f&RN2,v>3&ib~dB&+=WBW{Sr`dwJ =y`.YWn+ Pj|I,ޫ77W[@(_ #%hN@e1~b1a0,Kw|P~DV9wxc]Tq?CrJ缏B;⑯ر)B]MI*qNI$0 ;dU##݁=)SNSvfS/Sg $ΒBޜU)8=rUhGXeH\VȾM=?{"C *g3Z.ǚSr kNOTl2!M> s_VGz4i z/if-Z}A_/-^X$0呆9-#ù9*W%D!EU?%ԐVc`U`sJm>Sϯ!?